plexin B3 (PLXNB3) - coding DNA reference sequence

(used for variant description)

(last modified October 18, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_005393.2 in the PLXNB3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_013255.1, covering PLXNB3 transcript NM_005393.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5054
       gatgagtcggactgggcacgattgcattgtggggagggaggctggggctctgtg       c.-121

 .         .         .         .         .         .     | 02       g.6280
 agacgtgctcctggcaccgccagctgctacttggccctcgccggtggcccaccag | gacaa    c.-61

 .         .         .         .         .         .                g.6340
 tgcccccccgcagccatctcatgcccatcgccactgccctggggcagctgaactgagcgt       c.-1

          .         .         .         .      | 03  .         .    g.7692
 ATGTGCCACGCCGCCCAGGAGACCCCTCTGCTGCACCACTTCATG | GCCCCCGTGATGGCT    c.60
 M  C  H  A  A  Q  E  T  P  L  L  H  H  F  M   | A  P  V  M  A      p.20

          .         .         .         .         .         .       g.7752
 CGCTGGCCTCCCTTCGGCCTCTGCCTCCTCCTGCTGCTGCTGTCCCCACCGCCACTGCCC       c.120
 R  W  P  P  F  G  L  C  L  L  L  L  L  L  S  P  P  P  L  P         p.40

          .         .         .         .         .         .       g.7812
 TTGACAGGGGCCCATCGCTTCTCCGCACCTAATACCACTCTCAACCACTTGGCACTGGCA       c.180
 L  T  G  A  H  R  F  S  A  P  N  T  T  L  N  H  L  A  L  A         p.60

          .         .         .         .         .         .       g.7872
 CCTGGCCGAGGCACACTCTATGTCGGCGCAGTGAACCGCCTCTTCCAGCTCAGCCCCGAG       c.240
 P  G  R  G  T  L  Y  V  G  A  V  N  R  L  F  Q  L  S  P  E         p.80

          .         .         .         .         .         .       g.7932
 CTGCAGCTCGAGGCCGTGGCTGTCACTGGCCCTGTAATCGACAGCCCTGACTGCGTGCCC       c.300
 L  Q  L  E  A  V  A  V  T  G  P  V  I  D  S  P  D  C  V  P         p.100

          .         .         .         .         .         .       g.7992
 TTCCGTGACCCAGCCGAGTGCCCACAGGCCCAGCTCACTGACAATGCCAACCAGCTGCTG       c.360
 F  R  D  P  A  E  C  P  Q  A  Q  L  T  D  N  A  N  Q  L  L         p.120

          .         .         .         .         .         .       g.8052
 CTGGTGAGCAGCCGCGCCCAGGAGCTGGTGGCCTGCGGGCAGGTGCGGCAGGGCGTGTGT       c.420
 L  V  S  S  R  A  Q  E  L  V  A  C  G  Q  V  R  Q  G  V  C         p.140

          .         .         .         .         .         .       g.8112
 GAGACACGGCGCCTTGGGGATGTGGCCGAGGTGCTGTACCAGGCTGAGGACCCTGGTGAC       c.480
 E  T  R  R  L  G  D  V  A  E  V  L  Y  Q  A  E  D  P  G  D         p.160

          .         .         .         .         .         .       g.8172
 GGGCAGTTTGTGGCTGCCAATACCCCGGGAGTGGCAACGGTGGGGCTGGTGGTGCCCTTG       c.540
 G  Q  F  V  A  A  N  T  P  G  V  A  T  V  G  L  V  V  P  L         p.180

          .         .         .         .         .         .       g.8232
 CCCGGCCGGGACCTCCTGCTTGTGGCCAGAGGCCTGGCGGGCAAGCTGTCGGCAGGGGTG       c.600
 P  G  R  D  L  L  L  V  A  R  G  L  A  G  K  L  S  A  G  V         p.200

          .         .         .         .         .         .       g.8292
 CCACCCCTGGCCATCCGCCAGCTGGCCGGGTCTCAGCCCTTCTCCAGCGAGGGCCTGGGC       c.660
 P  P  L  A  I  R  Q  L  A  G  S  Q  P  F  S  S  E  G  L  G         p.220

          .         .         .         .         .         .       g.8352
 CGCCTGGTGGTGGGCGACTTCTCCGACTACAACAACAGCTACGTCGGGGCCTTTGCCGAC       c.720
 R  L  V  V  G  D  F  S  D  Y  N  N  S  Y  V  G  A  F  A  D         p.240

          .         .         .         .         .         .       g.8412
 GCCCGCTCCGCCTACTTCGTGTTCCGCCGCCGCGGGGCCCGGGCCCAGGCTGAGTACCGC       c.780
 A  R  S  A  Y  F  V  F  R  R  R  G  A  R  A  Q  A  E  Y  R         p.260

          .         .         .         .         .         .       g.8472
 TCCTACGTGGCCCGCGTCTGCCTGGGGGACACCAACCTGTACTCCTACGTGGAGGTCCCC       c.840
 S  Y  V  A  R  V  C  L  G  D  T  N  L  Y  S  Y  V  E  V  P         p.280

          .         .         .         .         .         .       g.8532
 CTCGCCTGCCAGGGCCAGGGCCTCATCCAGGCCGCCTTCCTTGCCCCGGGCACCTTGCTA       c.900
 L  A  C  Q  G  Q  G  L  I  Q  A  A  F  L  A  P  G  T  L  L         p.300

          .         .         .         .         .         .       g.8592
 GGGGTGTTTGCCGCGGGCCCAAGGGGCACCCAGGCGGCGCTCTGTGCCTTCCCCATGGTG       c.960
 G  V  F  A  A  G  P  R  G  T  Q  A  A  L  C  A  F  P  M  V         p.320

          .         .         .         .         .         .       g.8652
 GAGCTGGGTGCCAGCATGGAGCAGGCCCGGAGACTCTGCTACACGGCGGGCGGCCGGGGC       c.1020
 E  L  G  A  S  M  E  Q  A  R  R  L  C  Y  T  A  G  G  R  G         p.340

          .         .         .         .         .         .       g.8712
 CCCAGCGGCGCAGAGGAAGCCACCGTGGAGTACGGCGTCACGTCGCGCTGCGTCACCCTG       c.1080
 P  S  G  A  E  E  A  T  V  E  Y  G  V  T  S  R  C  V  T  L         p.360

        | 04 .         .         .         .         .         .    g.9107
 CCCCTT | GATTCCCCCGAGTCGTACCCCTGTGGCGACGAGCACACCCCCAGCCCCATTGCT    c.1140
 P  L   | D  S  P  E  S  Y  P  C  G  D  E  H  T  P  S  P  I  A      p.380

          .         .         .         .         .         .       g.9167
 GGCCGCCAGCCCCTGGAGGTCCAGCCTCTGCTGAAGCTCGGGCAGCCGGTCAGCGCCGTG       c.1200
 G  R  Q  P  L  E  V  Q  P  L  L  K  L  G  Q  P  V  S  A  V         p.400

          .         .         .         .         .         .       g.9227
 GCAGCTCTCCAGGCAGATGGGCACATGATAGCCTTCCTGGGGGACACCCAGGGCCAGCTG       c.1260
 A  A  L  Q  A  D  G  H  M  I  A  F  L  G  D  T  Q  G  Q  L         p.420

        | 05 .         .         .         .         .         .    g.9806
 TACAAG | GTCTTTCTCCACGGCTCCCAGGGCCAGGTTTACCACTCCCAGCAAGTGGGGCCT    c.1320
 Y  K   | V  F  L  H  G  S  Q  G  Q  V  Y  H  S  Q  Q  V  G  P      p.440

          .         .         .         .         .         .       g.9866
 CCAGGCTCAGCCATCAGCCCAGACCTGCTGCTGGACAGCAGTGGCAGTCACCTCTATGTC       c.1380
 P  G  S  A  I  S  P  D  L  L  L  D  S  S  G  S  H  L  Y  V         p.460

          .      | 06  .         .         .         .         .    g.10011
 CTGACTGCCCACCAG | GTGGACCGGATACCTGTGGCAGCCTGCCCCCAGTTCCCTGACTGT    c.1440
 L  T  A  H  Q   | V  D  R  I  P  V  A  A  C  P  Q  F  P  D  C      p.480

          .         .         .         .         .       | 07 .    g.10615
 GCCAGCTGCCTCCAGGCCCAGGACCCGCTGTGTGGCTGGTGTGTCCTCCAGGGCAG | GTGT    c.1500
 A  S  C  L  Q  A  Q  D  P  L  C  G  W  C  V  L  Q  G  R  |  C      p.500

          .         .         .         .         .         .       g.10675
 ACCCGGAAGGGCCAGTGCGGGCGGGCAGGCCAGCTGAACCAGTGGCTGTGGAGTTATGAG       c.1560
 T  R  K  G  Q  C  G  R  A  G  Q  L  N  Q  W  L  W  S  Y  E         p.520

          .         .         .         .         .         .       g.10735
 GAGGACAGCCACTGCCTGCACATCCAGAGCCTGCTGCCGGGCCACCACCCCCGCCAGGAG       c.1620
 E  D  S  H  C  L  H  I  Q  S  L  L  P  G  H  H  P  R  Q  E         p.540

           | 08        .         .         .         .         .    g.10947
 CAGGGCCAG | GTCACTTTGTCTGTCCCCCGGCTGCCCATCCTGGATGCAGATGAATACTTC    c.1680
 Q  G  Q   | V  T  L  S  V  P  R  L  P  I  L  D  A  D  E  Y  F      p.560

          .         .         .         .         .         .       g.11007
 CATTGTGCGTTCGGGGACTATGACAGCTTGGCTCATGTGGAAGGGCCCCACGTGGCCTGT       c.1740
 H  C  A  F  G  D  Y  D  S  L  A  H  V  E  G  P  H  V  A  C         p.580

          .         .         .         .       | 09 .         .    g.11156
 GTCACCCCTCCCCAAGACCAGGTGCCACTTAACCCTCCAGGCACAG | ACCACGTCACTGTG    c.1800
 V  T  P  P  Q  D  Q  V  P  L  N  P  P  G  T  D |   H  V  T  V      p.600

          .         .         .         .         .         .       g.11216
 CCCCTGGCCCTGATGTTCGAGGACGTGACTGTGGCTGCCACCAACTTCTCCTTTTATGAC       c.1860
 P  L  A  L  M  F  E  D  V  T  V  A  A  T  N  F  S  F  Y  D         p.620

          .         .         .      | 10  .         .         .    g.11357
 TGCAGTGCCGTCCAGGCCTTGGAGGCGGCTGCCCC | GTGTCGCGCTTGCGTGGGCAGCATC    c.1920
 C  S  A  V  Q  A  L  E  A  A  A  P  |  C  R  A  C  V  G  S  I      p.640

          .         .         .         .         .         .       g.11417
 TGGCGGTGTCACTGGTGCCCGCAGAGTAGCCACTGCGTGTACGGAGAGCACTGCCCAGAG       c.1980
 W  R  C  H  W  C  P  Q  S  S  H  C  V  Y  G  E  H  C  P  E         p.660

          .         .         . | 11       .         .         .    g.11592
 GGCGAGAGGACCATCTACAGCGCCCAGGAG | GTGGACATCCAGGTGCGTGGCCCAGGGGCT    c.2040
 G  E  R  T  I  Y  S  A  Q  E   | V  D  I  Q  V  R  G  P  G  A      p.680

          .         .         .         .         .         .       g.11652
 TGCCCACAGGTCGAAGGCCTGGCAGGTCCCCACCTGGTGCCTGTGGGCTGGGAGAGCCAT       c.2100
 C  P  Q  V  E  G  L  A  G  P  H  L  V  P  V  G  W  E  S  H         p.700

          .         .         .       | 12 .         .         .    g.11793
 TTGGCCCTACGCGTGCGGAACCTTCAACATTTCCGA | GGCCTGCCTGCCTCCTTCCACTGC    c.2160
 L  A  L  R  V  R  N  L  Q  H  F  R   | G  L  P  A  S  F  H  C      p.720

          .         .         .         .         .         .       g.11853
 TGGCTGGAGCTGCCTGGAGAACTTCGGGGACTGCCGGCCACCCTGGAGGAGACAGCAGGG       c.2220
 W  L  E  L  P  G  E  L  R  G  L  P  A  T  L  E  E  T  A  G         p.740

          .         .         .    | 13    .         .         .    g.12141
 GATTCAGGCCTCATCCACTGCCAGGCCCACCAG | TTTTATCCCTCCATGTCCCAGCGGGAG    c.2280
 D  S  G  L  I  H  C  Q  A  H  Q   | F  Y  P  S  M  S  Q  R  E      p.760

          .         .         .         .         .         .       g.12201
 CTCCCAGTGCCCATCTACGTCACCCAGGGTGAAGCCCAGAGGCTGGACAACACCCATGCT       c.2340
 L  P  V  P  I  Y  V  T  Q  G  E  A  Q  R  L  D  N  T  H  A         p.780

         | 14.         .         .         .         .         .    g.12343
 CTTTATG | TGATCCTGTACGACTGCGCCATGGGCCACCCGGACTGCAGCCACTGCCAAGCG    c.2400
 L  Y  V |   I  L  Y  D  C  A  M  G  H  P  D  C  S  H  C  Q  A      p.800

          .         .         .         .         .         .       g.12403
 GCCAACAGGAGCCTGGGCTGCCTGTGGTGTGCTGACGGCCAGCCTGCCTGTCGCTATGGG       c.2460
 A  N  R  S  L  G  C  L  W  C  A  D  G  Q  P  A  C  R  Y  G         p.820

          .         .         .         .         .        | 15.    g.12671
 CCCTTGTGCCCGCCGGGGGCTGTGGAGCTGCTGTGTCCTGCGCCCAGCATTGATGCA | GTC    c.2520
 P  L  C  P  P  G  A  V  E  L  L  C  P  A  P  S  I  D  A   | V      p.840

          .         .         .         .         .         .       g.12731
 GAGCCCCTGACCGGTCCCCCTGAGGGAGGCTTGGCCCTCACCATCCTGGGCTCCAACCTG       c.2580
 E  P  L  T  G  P  P  E  G  G  L  A  L  T  I  L  G  S  N  L         p.860

          .         .         .         .         .         .       g.12791
 GGCCGGGCCTTCGCCGATGTGCAGTACGCCGTGAGCGTGGCCAGCCGGCCCTGCAACCCT       c.2640
 G  R  A  F  A  D  V  Q  Y  A  V  S  V  A  S  R  P  C  N  P         p.880

          .         .          | 16        .         .         .    g.13017
 GAGCCCTCTCTCTACCGCACGTCGGCCCG | GATTGTGTGTGTGACATCTCCTGCCCCCAAT    c.2700
 E  P  S  L  Y  R  T  S  A  R  |  I  V  C  V  T  S  P  A  P  N      p.900

          .         .         .         .         .         .       g.13077
 GGCACCACTGGGCCCGTCCGGGTGGCCATTAAGAGCCAGCCACCAGGCATCTCAAGCCAG       c.2760
 G  T  T  G  P  V  R  V  A  I  K  S  Q  P  P  G  I  S  S  Q         p.920

          .      | 17  .         .         .         .         .    g.13735
 CACTTCACCTACCAG | GACCCTGTCCTGCTGAGCCTGAGTCCTCGCTGGGGCCCCCAGGCA    c.2820
 H  F  T  Y  Q   | D  P  V  L  L  S  L  S  P  R  W  G  P  Q  A      p.940

          .         .         .         .         .         .       g.13795
 GGGGGCACCCAGCTCACCATCCGAGGTCAGCACCTCCAGACAGGTGGCAACACCAGTGCC       c.2880
 G  G  T  Q  L  T  I  R  G  Q  H  L  Q  T  G  G  N  T  S  A         p.960

          .         .       | 18 .         .         .         .    g.14068
 TTCGTGGGTGGCCAACCCTGTCCCAT | CCTGGAGCCAGTGTGTCCGGAGGCCATCGTGTGC    c.2940
 F  V  G  G  Q  P  C  P  I  |  L  E  P  V  C  P  E  A  I  V  C      p.980

          .         .         .         .         .         .       g.14128
 CGTACCAGGCCCCAGGCTGCCCCAGGAGAAGCAGCGGTCCTTGTGGTCTTTGGCCATGCC       c.3000
 R  T  R  P  Q  A  A  P  G  E  A  A  V  L  V  V  F  G  H  A         p.1000

          .         .         .         .         .         .       g.14188
 CAGCGCACACTGCTCGCCAGCCCCTTCCGCTACACCGCCAACCCCCAGCTTGTAGCGGCG       c.3060
 Q  R  T  L  L  A  S  P  F  R  Y  T  A  N  P  Q  L  V  A  A         p.1020

          .         .    | 19    .         .         .         .    g.14359
 GAGCCCAGTGCCAGCTTCCGGGG | GGGTGGGCGACTGATCCGTGTCAGGGGCACCGGCCTA    c.3120
 E  P  S  A  S  F  R  G  |  G  G  R  L  I  R  V  R  G  T  G  L      p.1040

          .         .         .         .         .         .       g.14419
 GACGTGGTGCAGCGGCCCCTACTGTCTGTGTGGCTGGAGGCTGACGCAGAGGTGCAGGCT       c.3180
 D  V  V  Q  R  P  L  L  S  V  W  L  E  A  D  A  E  V  Q  A         p.1060

          .         .         .         .         .         .       g.14479
 TCCAGGGCCCAGCCCCAGGACCCACAGCCAAGGAGGAGCTGTGGAGCCCCTGCTGCGGAC       c.3240
 S  R  A  Q  P  Q  D  P  Q  P  R  R  S  C  G  A  P  A  A  D         p.1080

          .         .         .          | 20        .         .    g.14684
 CCCCAGGCTTGTATCCAGCTCGGTGGGGGGCTGCTGCAG | TGCTCCACCGTCTGCTCCGTC    c.3300
 P  Q  A  C  I  Q  L  G  G  G  L  L  Q   | C  S  T  V  C  S  V      p.1100

          .         .         .         .         .         .       g.14744
 AACTCGTCCAGCCTCCTCCTGTGCCGGAGCCCTGCTGTACCAGACAGAGCCCACCCGCAG       c.3360
 N  S  S  S  L  L  L  C  R  S  P  A  V  P  D  R  A  H  P  Q         p.1120

          .         .         .         .         .         .       g.14804
 CGGGTCTTCTTCACCCTAGACAACGTGCAAGTGGACTTCGCCAGTGCCAGTGGGGGCCAG       c.3420
 R  V  F  F  T  L  D  N  V  Q  V  D  F  A  S  A  S  G  G  Q         p.1140

          .         .         .         .         .         .       g.14864
 GGCTTCCTGTACCAGCCCAACCCCCGCCTGGCACCCCTCAGCCGCGAGGGGCCTGCCCGC       c.3480
 G  F  L  Y  Q  P  N  P  R  L  A  P  L  S  R  E  G  P  A  R         p.1160

          .         .         .          | 21        .         .    g.15011
 CCCTACCGCCTCAAGCCAGGCCATGTCCTGGATGTGGAG | GGCGAGGGCCTCAACCTGGGC    c.3540
 P  Y  R  L  K  P  G  H  V  L  D  V  E   | G  E  G  L  N  L  G      p.1180

          .         .         .         .         .         .       g.15071
 ATCAGCAAGGAGGAGGTGCGCGTGCACATCGGCCGCGGCGAGTGCCTGGTGAAGACGCTC       c.3600
 I  S  K  E  E  V  R  V  H  I  G  R  G  E  C  L  V  K  T  L         p.1200

          .         .         .         .         .         .       g.15131
 ACGCGCACCCACCTGTACTGCGAGCCGCCTGCGCACGCCCCGCAGCCTGCCAATGGCTCC       c.3660
 T  R  T  H  L  Y  C  E  P  P  A  H  A  P  Q  P  A  N  G  S         p.1220

          .         | 22         .         .         .         .    g.15266
 GGCCTGCCACAGTTCGTG | GTGCAGATGGGCAATGTGCAGCTGGCCCTGGGCCCTGTGCAG    c.3720
 G  L  P  Q  F  V   | V  Q  M  G  N  V  Q  L  A  L  G  P  V  Q      p.1240

          .         .         .         .         .         .       g.15326
 TACGAGGCTGAACCCCCGCTGTCTGCCTTTCCCGTGGAGGCCCAGGCAGGCGTGGGCATG       c.3780
 Y  E  A  E  P  P  L  S  A  F  P  V  E  A  Q  A  G  V  G  M         p.1260

          .         .         .         .         . | 23       .    g.15520
 GGTGCTGCAGTGCTGATTGCCGCCGTGCTCCTCCTCACCCTCATGTACAG | GCACAAGAGC    c.3840
 G  A  A  V  L  I  A  A  V  L  L  L  T  L  M  Y  R  |  H  K  S      p.1280

          .         .         .         .         .         .       g.15580
 AAGCAGGCCCTGCGGGACTACCAGAAGGTGCTAGTGCAGCTGGAGAGCCTGGAGACCGGC       c.3900
 K  Q  A  L  R  D  Y  Q  K  V  L  V  Q  L  E  S  L  E  T  G         p.1300

          .         .         .  | 24      .         .         .    g.15713
 GTGGGAGACCAGTGCCGCAAGGAGTTCACAG | ACCTCATGACGGAGATGACCGACCTCAGC    c.3960
 V  G  D  Q  C  R  K  E  F  T  D |   L  M  T  E  M  T  D  L  S      p.1320

          .         .         .         .         .         .       g.15773
 AGCGACCTGGAGGGCAGCGGGATCCCCTTCCTGGACTACCGCACCTACGCCGAGCGCGCC       c.4020
 S  D  L  E  G  S  G  I  P  F  L  D  Y  R  T  Y  A  E  R  A         p.1340

          .         .         .         .         .         .       g.15833
 TTCTTCCCTGGCCATGGCGGTTGCCCGCTGCAGCCCAAGCCTGAGGGGCCAGGGGAGGAC       c.4080
 F  F  P  G  H  G  G  C  P  L  Q  P  K  P  E  G  P  G  E  D         p.1360

          .         .         .         .         .         .       g.15893
 GGCCACTGTGCCACTGTGCGCCAGGGCCTCACGCAGCTCTCCAACCTGCTCAACAGCAAG       c.4140
 G  H  C  A  T  V  R  Q  G  L  T  Q  L  S  N  L  L  N  S  K         p.1380

          .      | 25  .         .         .         .         .    g.16074
 CTCTTCCTCCTCACG | CTCATCCACACCCTGGAGGAGCAGCCCAGCTTTTCCCAGAGGGAT    c.4200
 L  F  L  L  T   | L  I  H  T  L  E  E  Q  P  S  F  S  Q  R  D      p.1400

          .         .         .         .         .         .       g.16134
 CGCTGCCATGTGGCTTCGCTGCTGTCGCTAGCGCTACACGGCAAGCTGGAGTACCTGACG       c.4260
 R  C  H  V  A  S  L  L  S  L  A  L  H  G  K  L  E  Y  L  T         p.1420

          .         .         .         .         .         .       g.16194
 GACATCATGAGGACCCTGCTGGGTGACCTGGCGGCCCATTACGTGCACAGGAACCCCAAG       c.4320
 D  I  M  R  T  L  L  G  D  L  A  A  H  Y  V  H  R  N  P  K         p.1440

          .     | 26   .         .         .         .         .    g.16444
 CTCATGCTACGCAG | GACAGAGACCATGGTGGAGAAACTGCTCACCAACTGGCTGTCCATC    c.4380
 L  M  L  R  R  |  T  E  T  M  V  E  K  L  L  T  N  W  L  S  I      p.1460

          .         .  | 27      .         .         .         .    g.16730
 TGCCTGTACGCCTTCCTGAGG | GAGGTGGCTGGTGAACCACTGTACATGCTCTTCCGGGCC    c.4440
 C  L  Y  A  F  L  R   | E  V  A  G  E  P  L  Y  M  L  F  R  A      p.1480

          .         .         .         .         .         .       g.16790
 ATCCAGTACCAGGTGGACAAAGGCCCCGTGGACGCCGTGACAGGCAAGGCCAAACGGACC       c.4500
 I  Q  Y  Q  V  D  K  G  P  V  D  A  V  T  G  K  A  K  R  T         p.1500

          .         .         .         .         .         .       g.16850
 CTGAATGATAGCCGCTTGCTGCGGGAGGACGTGGAGTTCCAGCCCCTGACGCTGATGGTG       c.4560
 L  N  D  S  R  L  L  R  E  D  V  E  F  Q  P  L  T  L  M  V         p.1520

          .         .         .         .         .         .       g.16910
 CTGGTGGGGCCCGGGGCTGGCGGGGCCGCAGGCAGCAGCGAGATGCAGCGCGTGCCAGCC       c.4620
 L  V  G  P  G  A  G  G  A  A  G  S  S  E  M  Q  R  V  P  A         p.1540

          .         .         .         .         .         .       g.16970
 CGGGTGCTCGACACGGACACCATCACCCAGGTCAAGGAGAAGGTGTTGGACCAAGTCTAC       c.4680
 R  V  L  D  T  D  T  I  T  Q  V  K  E  K  V  L  D  Q  V  Y         p.1560

          .         .         .         .          | 28        .    g.17171
 AAGGGCACCCCCTTCTCCCAGAGGCCCTCAGTGCATGCCCTAGACCTTG | AGTGGCGCTCA    c.4740
 K  G  T  P  F  S  Q  R  P  S  V  H  A  L  D  L  E |   W  R  S      p.1580

          .         .         .         .         .         .       g.17231
 GGCCTGGCTGGTCACCTGACCCTATCGGACGAAGACTTGACCTCCGTGACCCAAAACCAC       c.4800
 G  L  A  G  H  L  T  L  S  D  E  D  L  T  S  V  T  Q  N  H         p.1600

          .         .         .    | 29    .         .         .    g.17718
 TGGAAGAGACTCAACACCTTGCAACACTACAAG | GTCCCAGATGGAGCAACAGTGGGGCTC    c.4860
 W  K  R  L  N  T  L  Q  H  Y  K   | V  P  D  G  A  T  V  G  L      p.1620

          .         .         .         .         .         .       g.17778
 GTCCCTCAGCTGCACCGTGGCAGCACCATCTCCCAGAGCCTGGCCCAGAGGTGCCCCTTG       c.4920
 V  P  Q  L  H  R  G  S  T  I  S  Q  S  L  A  Q  R  C  P  L         p.1640

         | 30.         .         .         .         .         .    g.18065
 GGAGAGA | ACATACCCACGCTGGAGGATGGCGAGGAGGGGGGGGTGTGCCTCTGGCACCTG    c.4980
 G  E  N |   I  P  T  L  E  D  G  E  E  G  G  V  C  L  W  H  L      p.1660

          .         .         .         .         .         .       g.18125
 GTGAAAGCCACCGAGGAGCCAGAAGGGGCCAAGGTGCGGTGCAGCAGCCTGCGGGAGCGC       c.5040
 V  K  A  T  E  E  P  E  G  A  K  V  R  C  S  S  L  R  E  R         p.1680

          .         .         .         .         .         .       g.18185
 GAGCCAGCAAGGGCCAAGGCCATTCCGGAAATCTACCTCACCCGTCTGCTGTCCATGAAG       c.5100
 E  P  A  R  A  K  A  I  P  E  I  Y  L  T  R  L  L  S  M  K         p.1700

  | 31       .         .         .         .         .         .    g.18392
  | GGCACGCTGCAGAAGTTTGTGGACGACACCTTCCAGGCCATTCTCAGCGTGAACCGGCCC    c.5160
  | G  T  L  Q  K  F  V  D  D  T  F  Q  A  I  L  S  V  N  R  P      p.1720

          .         .         .         .         .         .       g.18452
 ATCCCCATCGCCGTCAAGTACCTGTTTGACCTTCTGGATGAGCTAGCAGAGAAGCACGGC       c.5220
 I  P  I  A  V  K  Y  L  F  D  L  L  D  E  L  A  E  K  H  G         p.1740

          .         .         .         .  | 32      .         .    g.18771
 ATCGAGGACCCAGGGACCCTGCACATCTGGAAGACCAACAG | TCTGCTGCTGCGGTTCTGG    c.5280
 I  E  D  P  G  T  L  H  I  W  K  T  N  S  |  L  L  L  R  F  W      p.1760

          .         .         .         .         .         .       g.18831
 GTGAATGCCTTGAAGAACCCACAGCTCATCTTTGATGTACGGGTGTCGGACAATGTGGAC       c.5340
 V  N  A  L  K  N  P  Q  L  I  F  D  V  R  V  S  D  N  V  D         p.1780

          .         .         .         .         .         .       g.18891
 GCCATCCTTGCTGTCATCGCCCAGACCTTCATTGACTCCTGTACCACCTCGGAGCATAAA       c.5400
 A  I  L  A  V  I  A  Q  T  F  I  D  S  C  T  T  S  E  H  K         p.1800

           | 33        .         .         .         .         .    g.19116
 GTGGGCCGG | GATTCCCCAGTGAACAAACTGCTCTACGCCCGGGAGATCCCACGCTACAAG    c.5460
 V  G  R   | D  S  P  V  N  K  L  L  Y  A  R  E  I  P  R  Y  K      p.1820

          .     | 34   .         .         .         .         .    g.19246
 CAGATGGTGGAGAG | GTACTATGCGGACATTCGCCAGAGCTCTCCGGCGAGCTACCAGGAG    c.5520
 Q  M  V  E  R  |  Y  Y  A  D  I  R  Q  S  S  P  A  S  Y  Q  E      p.1840

          .         .         . | 35       .         .         .    g.19434
 ATGAACTCTGCTTTGGCTGAGCTCTCCGGG | AACTACACTTCTGCTCCCCACTGTCTGGAG    c.5580
 M  N  S  A  L  A  E  L  S  G   | N  Y  T  S  A  P  H  C  L  E      p.1860

          .         .         .         .      | 36  .         .    g.19754
 GCTCTGCAAGAACTCTACAACCACATCCACAGGTACTATGATCAG | ATTATCAGTGCCCTG    c.5640
 A  L  Q  E  L  Y  N  H  I  H  R  Y  Y  D  Q   | I  I  S  A  L      p.1880

          .         .         .         .         .         .       g.19814
 GAGGAGGACCCTGTGGGCCAGAAGCTGCAGCTGGCCTGCCGCCTGCAGCAGGTCGCCGCC       c.5700
 E  E  D  P  V  G  Q  K  L  Q  L  A  C  R  L  Q  Q  V  A  A         p.1900

          .         .         .                                     g.19844
 CTGGTGGAAAACAAAGTGACTGACCTGTGA                                     c.5730
 L  V  E  N  K  V  T  D  L  X                                       p.1909

          .         .         .         .         .         .       g.19904
 gctctggctcagacagcagcaagccggatccaccaacaccgcagcgccttatgaccccgg       c.*60

          .         .         .         .         .         .       g.19964
 aaccgagccagccactgaggggagctggcagagcctgggggcacagggtgcaaagccagg       c.*120

          .         .         .         .         .         .       g.20024
 cactgtgcccagcagtgggctccctgcctgccacctcccctgccagcccacccaccttcc       c.*180

          .         .         .         .         .         .       g.20084
 ccccacctgagattgtttctaatttataaggatccccctccttccccctctccccattgt       c.*240

          .         .         .         .         .         .       g.20144
 atttatttgcctgctggaaaatcacatccggaaataaaatagaaatatgtctttttattt       c.*300

                                                                    g.20151
 tattttg                                                            c.*307

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Plexin B3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 14
©2004-2015 Leiden University Medical Center