patatin-like phospholipase domain containing 4 (PNPLA4) - coding DNA reference sequence

(used for variant description)

(last modified March 30, 2017)

This file was created to facilitate the description of sequence variants on transcript NM_004650.2 in the PNPLA4 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_016624.1, covering PNPLA4 transcript NM_004650.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5347
                   ggtaccaacccctgccgcaggactttcctgggccggctcgcg       c.-121

 .         .         .         .         .         .                g.5407
 gagagcgtagcgcggccttggtggcggaatggcgttgagtgacggcccggccccgccatc       c.-61

 .         .         .         .         .       | 02 .             g.6620
 tggttaaagggactcgttcaacacggaagtgtcccggggctgcattg | tgctacagctaga    c.-1

          .         .         .         .         .         .       g.6680
 ATGAAGCACATCAACCTATCATTTGCAGCGTGTGGATTTCTGGGCATTTACCACTTGGGG       c.60
 M  K  H  I  N  L  S  F  A  A  C  G  F  L  G  I  Y  H  L  G         p.20

          .         .         .         .         .         .       g.6740
 GCAGCATCTGCACTTTGCAGACATGGCAAAAAACTTGTGAAGGATGTCAAAGCCTTCGCT       c.120
 A  A  S  A  L  C  R  H  G  K  K  L  V  K  D  V  K  A  F  A         p.40

          .         .         .         .         .         .       g.6800
 GGGGCGTCTGCGGGATCGTTGGTTGCTTCTGTTCTGCTAACAGCACCAGAAAAAATAGAG       c.180
 G  A  S  A  G  S  L  V  A  S  V  L  L  T  A  P  E  K  I  E         p.60

  | 03       .         .         .         .         .         .    g.10701
  | GAATGTAACCAATTTACCTACAAGTTTGCCGAAGAAATCAGAAGGCAGTCTTTCGGGGCA    c.240
  | E  C  N  Q  F  T  Y  K  F  A  E  E  I  R  R  Q  S  F  G  A      p.80

          .         .         .      | 04  .         .         .    g.10916
 GTAACGCCCGGTTATGACTTCATGGCCCGACTAAG | AAGTGGGATGGAGTCGATTCTTCCT    c.300
 V  T  P  G  Y  D  F  M  A  R  L  R  |  S  G  M  E  S  I  L  P      p.100

          .         .         .         .         .         .       g.10976
 CCCAGCGCTCACGAGCTGGCCCAGAACCGACTGCACGTATCCATCACCAACGCCAAAACC       c.360
 P  S  A  H  E  L  A  Q  N  R  L  H  V  S  I  T  N  A  K  T         p.120

          .         .         .         .         .  | 05      .    g.20655
 AGAGAAAATCACTTAGTCTCCACTTTTTCCTCCAGGGAGGACCTCATTAAG | GTCCTCCTA    c.420
 R  E  N  H  L  V  S  T  F  S  S  R  E  D  L  I  K   | V  L  L      p.140

          .         .         .         .         .        | 06.    g.30601
 GCCAGCAGTTTTGTGCCCATTTATGCAGGACTGAAGCTAGTGGAATACAAAGGGCAG | AAG    c.480
 A  S  S  F  V  P  I  Y  A  G  L  K  L  V  E  Y  K  G  Q   | K      p.160

          .         .         .         .         .         .       g.30661
 TGGGTGGACGGAGGCCTCACCAACGCTCTTCCCATCCTGCCCGTCGGCCGGACAGTAACC       c.540
 W  V  D  G  G  L  T  N  A  L  P  I  L  P  V  G  R  T  V  T         p.180

          .         .         .         .         .         .       g.30721
 ATCTCCCCCTTCAGTGGACGACTGGACATCTCCCCGCAGGACAAAGGGCAGCTAGATCTG       c.600
 I  S  P  F  S  G  R  L  D  I  S  P  Q  D  K  G  Q  L  D  L         p.200

          .         .         . | 07       .         .         .    g.31952
 TATGTTAATATCGCCAAGCAGGATATCATG | TTGTCCCTGGCAAACCTGGTGAGACTCAAC    c.660
 Y  V  N  I  A  K  Q  D  I  M   | L  S  L  A  N  L  V  R  L  N      p.220

          .         .         .         .         .         .       g.32012
 CAAGCCCTTTTTCCCCCAAGCAAGAGGAAAATGGAATCTTTGTATCAGTGTGGTTTTGAT       c.720
 Q  A  L  F  P  P  S  K  R  K  M  E  S  L  Y  Q  C  G  F  D         p.240

          .         .         .         .                           g.32054
 GACACTGTTAAGTTTTTACTTAAAGAAAATTGGTTTGAATAA                         c.762
 D  T  V  K  F  L  L  K  E  N  W  F  E  X                           p.253

          .         .         .         .         .         .       g.32114
 aatgcataaaagtttataatgcaaaacacgttttagatagtttttgatggaagtttctaa       c.*60

          .         .         .         .         .         .       g.32174
 tcaaatcctttttagaaaatctatcatgactcaattgtattactccttgtaatatttgtg       c.*120

          .         .         .         .         .         .       g.32234
 tttatttttaatatttgaattattacttagcacatggatataagaggcactttattagaa       c.*180

          .         .         .         .         .         .       g.32294
 tttgacaacgtcattaagaaggatacacttaggtgataaggaatcatttttggtgaactg       c.*240

          .         .         .         .         .         .       g.32354
 ttgtgtcctttaaaaaatggaggaggataggttctttgggtaaattgaggaacatggaaa       c.*300

          .         .         .         .         .         .       g.32414
 atggagggccaccacttaggttccatggagaatatgtggcatgatcttgacgtgaagcat       c.*360

          .         .         .         .         .         .       g.32474
 gggtgtttccgtgacttagctgtgtccctgtagctctggaactgaaggaactaggtagga       c.*420

          .         .         .         .         .         .       g.32534
 gaggaaggatttgagaaataggcaactcatggttaaagacctttgatcaggactggagga       c.*480

          .         .         .         .         .         .       g.32594
 acaaaggtttgtgtattagtccattttcacactgctgagaaagacatacccaagactggg       c.*540

          .         .         .         .         .         .       g.32654
 caatttacaaaagaaaggtttaatgggctcacagttccacatgactgaggaggcctcaca       c.*600

          .         .         .         .         .         .       g.32714
 attgtggtggaaggtgaaaggcatgtctcacatggcagcagacaagagaagaaaacttgt       c.*660

          .         .         .         .         .         .       g.32774
 gcagggaaactcccctttataaaaccatcggatctcttgagactcgttcactatcatgag       c.*720

          .         .         .         .         .         .       g.32834
 aatagcatgggaaagacctgcctccatgattcagttacctcccactgggtccctcccaca       c.*780

          .         .         .         .         .         .       g.32894
 acgtgtggcaattgtgggagctacatacacttcaagatgagatttgggtggggacacagc       c.*840

          .         .         .         .         .         .       g.32954
 caaaccataacagtttgctttccacaggtgtgtgcagttgctcccagtgcagttaggggc       c.*900

          .         .         .         .         .         .       g.33014
 agatatccagaagcctaggagattttgaagaggcttatcccctctcatcttcctccccta       c.*960

          .         .         .         .         .         .       g.33074
 aaccccaccccagtttaggagattatcaagctggttgtcattcattctctctctctctct       c.*1020

          .         .         .         .         .         .       g.33134
 ctctctctctctctctctctctctctctctctctctctcgccatacctctctgagtattt       c.*1080

          .         .         .         .         .         .       g.33194
 agctattgttctatatactggatacatctattatgggaacttaaatagataaaatactac       c.*1140

          .         .         .         .         .         .       g.33254
 taaacacaaagaaccaagtagcctagtaaataagaattaaatccagaataatcattcact       c.*1200

          .         .         .         .         .         .       g.33314
 tctcatttttaaatcacgttgtactgatcccaggttttttactttctgagtagttgtcca       c.*1260

          .         .         .         .         .         .       g.33374
 tcactttgaggacttgtgtatgggcttgtaccaatttactgacactgtcttaaatcctaa       c.*1320

          .         .         .         .         .         .       g.33434
 atctgtttttatgaggttttgccaagcaagaactcttgattactaagaggcagttagaga       c.*1380

          .         .         .         .         .         .       g.33494
 caaaccaatttaattccatgtcttcaattgtcacgcatttcttcttttactctttgaaac       c.*1440

          .         .         .         .         .         .       g.33554
 tattctttgagtcaattttatggttctcagaagccaaaatacacaacttttagcacataa       c.*1500

          .         .         .         .         .         .       g.33614
 acaccaacgatggcctctttttgaggagttatgcatagacccactctagagtaatgatgg       c.*1560

          .         .         .         .         .         .       g.33674
 tccctgtggtatatactttctcctactctagcaaacatgtagtttaatcttaatgtgttg       c.*1620

          .         .         .         .         .         .       g.33734
 tttccataagtgacatgaagtggatagattctcaattgttatgtccacttattcactagg       c.*1680

          .         .         .         .         .         .       g.33794
 taaattttcagttttaatacttttctccttaccccttcctttgatcatttcatgtgaata       c.*1740

          .         .         .         .         .         .       g.33854
 ttctatttgtatgatacactgtatttcaataaattccttgttgatgtacccttaaattga       c.*1800

          .         .         .         .         .         .       g.33914
 agaaatttaagctgcaaaaccaaatctcattgtataagacttttttgaagtatcttgtat       c.*1860

          .         .         .         .         .         .       g.33974
 cgactacatatgtatttgaccctgtgggaggatggtacttttctttttaacttttatttt       c.*1920

                                                                    g.33977
 aag                                                                c.*1923

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Patatin-like phospholipase domain containing 4 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.