polymerase (RNA) I polypeptide D, 16kDa (POLR1D) - coding DNA reference sequence

(used for variant description)

(last modified December 13, 2022)

This file was created to facilitate the description of sequence variants on transcript NM_015972.3 in the POLR1D gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000013.10, covering POLR1D transcript NM_015972.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.6061
                                    gtcggggcgggggctgggggtggag       c.-181

 .         .         .         .         .         .                g.6121
 cctcatgccccgccccgcggctgggccctgccgcgccgctgcggctcctcctccctcctt       c.-121

 .         .         .         .         .         .                g.6181
 ccgtcctccgcgccttccgtcggtcggtccttgcttcctgcttcgcctccgcgcctcgcg       c.-61

 .         .         .         .         .         .                g.6241
 ctatgggacagagcccccgatccgccagcaccacctgaggatccagaaaccgccccagcg       c.-1

          .         .       | 02 .         .         .         .    g.7166
 ATGGAAGAGGATCAGGAGCTGGAGAG | AAAAATATCTGGATTGAAGACCTCAATGGCTGAA    c.60
 M  E  E  D  Q  E  L  E  R  |  K  I  S  G  L  K  T  S  M  A  E      p.20

          .         .         .         .         .         .       g.7226
 GGCGAGAGGAAGACAGCCCTGGAAATGGTCCAGGCAGCTGGAACAGATAGACACTGTGTG       c.120
 G  E  R  K  T  A  L  E  M  V  Q  A  A  G  T  D  R  H  C  V         p.40

          .         .         .         .         .         .       g.7286
 ACATTTGTATTGCACGAGGAAGACCATACCCTAGGAAATTCTCTACGTTACATGATCATG       c.180
 T  F  V  L  H  E  E  D  H  T  L  G  N  S  L  R  Y  M  I  M         p.60

          .         .         .         .         .         .       g.7346
 AAGAACCCGGAAGTGGAATTTTGTGGTTACACTACGACCCATCCTTCAGAGAGCAAAATT       c.240
 K  N  P  E  V  E  F  C  G  Y  T  T  T  H  P  S  E  S  K  I         p.80

          .         .         .         .         .         .       g.7406
 AATTTACGCATTCAGACTCGAGGTACCCTTCCAGCTGTTGAGCCATTTCAGAGAGGCCTG       c.300
 N  L  R  I  Q  T  R  G  T  L  P  A  V  E  P  F  Q  R  G  L         p.100

          .         .         .         .         .         .       g.7466
 AATGAGCTCATGAATGTCTGCCAACATGTGCTTGACAAGTTTGAGGCCAGCATAAAGGAC       c.360
 N  E  L  M  N  V  C  Q  H  V  L  D  K  F  E  A  S  I  K  D         p.120

          .         .         .         .                           g.7508
 TATAAGGATCAAAAAGCAAGCAGAAATGAATCCACATTCTAG                         c.402
 Y  K  D  Q  K  A  S  R  N  E  S  T  F  X                           p.133

          .         .         .         .         .         .       g.7568
 tcctttatgcagtatacaaggagaactgtcctgtaggatattctcttcctgatggtgcag       c.*60

          .         .         .         .         .         .       g.7628
 aacccagaattagaagtttgtggttacagcatactctgtccttcagaaaggcgtgattct       c.*120

          .         .         .         .         .         .       g.7688
 agctgttgaccccttgcagctgttggaatctctgcaagaacctctgtattcttctaataa       c.*180

          .         .                                               g.7711
 attccctcttttatttaaactag                                            c.*203

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Polymerase (RNA) I polypeptide D, 16kDa protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.