proopiomelanocortin (POMC) - coding DNA reference sequence

(used for variant description)

(last modified January 13, 2022)

This file was created to facilitate the description of sequence variants on transcript NM_000939.2 in the POMC gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000002.11, covering POMC transcript NM_000939.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5033
                            ccttcccctggcccggggagctgctccttgtgc       c.-181

 .         .         .         .         .         .                g.5093
 tgccgggaaggtcaaagtcccgcgcccaccaggagagctcggcaagtatataaggacaga       c.-121

 .         .         .         .         .         .                g.5153
 ggagcgcgggaccaagcggcggcgaaggaggggaagaagagccgcgaccgagagaggccg       c.-61

 .         .         .         .          | 02        .             g.8918
 ccgagcgtccccgccctcagagagcagcctcccgagacag | agcctcagcctgcctggaag    c.-1

          .         .         .         .         .         .       g.8978
 ATGCCGAGATCGTGCTGCAGCCGCTCGGGGGCCCTGTTGCTGGCCTTGCTGCTTCAGGCC       c.60
 M  P  R  S  C  C  S  R  S  G  A  L  L  L  A  L  L  L  Q  A         p.20

          .         .         .         .         .         .       g.9038
 TCCATGGAAGTGCGTGGCTGGTGCCTGGAGAGCAGCCAGTGTCAGGACCTCACCACGGAA       c.120
 S  M  E  V  R  G  W  C  L  E  S  S  Q  C  Q  D  L  T  T  E         p.40

          .   | 03     .         .         .         .         .    g.11986
 AGCAACCTGCTG | GAGTGCATCCGGGCCTGCAAGCCCGACCTCTCGGCCGAGACTCCCATG    c.180
 S  N  L  L   | E  C  I  R  A  C  K  P  D  L  S  A  E  T  P  M      p.60

          .         .         .         .         .         .       g.12046
 TTCCCGGGAAATGGCGACGAGCAGCCTCTGACCGAGAACCCCCGGAAGTACGTCATGGGC       c.240
 F  P  G  N  G  D  E  Q  P  L  T  E  N  P  R  K  Y  V  M  G         p.80

          .         .         .         .         .         .       g.12106
 CACTTCCGCTGGGACCGATTCGGCCGCCGCAACAGCAGCAGCAGCGGCAGCAGCGGCGCA       c.300
 H  F  R  W  D  R  F  G  R  R  N  S  S  S  S  G  S  S  G  A         p.100

          .         .         .         .         .         .       g.12166
 GGGCAGAAGCGCGAGGACGTCTCAGCGGGCGAAGACTGCGGCCCGCTGCCTGAGGGCGGC       c.360
 G  Q  K  R  E  D  V  S  A  G  E  D  C  G  P  L  P  E  G  G         p.120

          .         .         .         .         .         .       g.12226
 CCCGAGCCCCGCAGCGATGGTGCCAAGCCGGGCCCGCGCGAGGGCAAGCGCTCCTACTCC       c.420
 P  E  P  R  S  D  G  A  K  P  G  P  R  E  G  K  R  S  Y  S         p.140

          .         .         .         .         .         .       g.12286
 ATGGAGCACTTCCGCTGGGGCAAGCCGGTGGGCAAGAAGCGGCGCCCAGTGAAGGTGTAC       c.480
 M  E  H  F  R  W  G  K  P  V  G  K  K  R  R  P  V  K  V  Y         p.160

          .         .         .         .         .         .       g.12346
 CCTAACGGCGCCGAGGACGAGTCGGCCGAGGCCTTCCCCCTGGAGTTCAAGAGGGAGCTG       c.540
 P  N  G  A  E  D  E  S  A  E  A  F  P  L  E  F  K  R  E  L         p.180

          .         .         .         .         .         .       g.12406
 ACTGGCCAGCGACTCCGGGAGGGAGATGGCCCCGACGGCCCTGCCGATGACGGCGCAGGG       c.600
 T  G  Q  R  L  R  E  G  D  G  P  D  G  P  A  D  D  G  A  G         p.200

          .         .         .         .         .         .       g.12466
 GCCCAGGCCGACCTGGAGCACAGCCTGCTGGTGGCGGCCGAGAAGAAGGACGAGGGCCCC       c.660
 A  Q  A  D  L  E  H  S  L  L  V  A  A  E  K  K  D  E  G  P         p.220

          .         .         .         .         .         .       g.12526
 TACAGGATGGAGCACTTCCGCTGGGGCAGCCCGCCCAAGGACAAGCGCTACGGCGGTTTC       c.720
 Y  R  M  E  H  F  R  W  G  S  P  P  K  D  K  R  Y  G  G  F         p.240

          .         .         .         .         .         .       g.12586
 ATGACCTCCGAGAAGAGCCAGACGCCCCTGGTGACGCTGTTCAAAAACGCCATCATCAAG       c.780
 M  T  S  E  K  S  Q  T  P  L  V  T  L  F  K  N  A  I  I  K         p.260

          .         .                                               g.12610
 AACGCCTACAAGAAGGGCGAGTGA                                           c.804
 N  A  Y  K  K  G  E  X                                             p.267

          .         .         .         .         .         .       g.12670
 gggcacagcggggccccagggctaccctcccccaggaggtcgaccccaaagccccttgct       c.*60

          .         .         .         .         .         .       g.12730
 ctcccctgccctgctgccgcctcccagcctggggggtcgtggcagataatcagcctctta       c.*120

          .         .         .         .         .         .       g.12790
 aagctgcctgtagttaggaaataaaacctttcaaatttcacatccacctctgactttgaa       c.*180

          .         .         .         .                           g.12838
 tgtaaactgtgtgaataaagtaaaaatacgtagccgtcaaataacagc                   c.*228

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Proopiomelanocortin protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.