proteasome maturation protein (POMP) - coding DNA reference sequence

(used for variant description)

(last modified September 6, 2015)

This file was created to facilitate the description of sequence variants on transcript NM_015932.5 in the POMP gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_027550.1, covering POMP transcript NM_015932.5.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.5001
                                                            a       c.-181

 .         .         .         .         .         .                g.5061
 ttgcaagcgtgggagcctcggccccgcgcagctccctccggcgtcccgcgccctccttcc       c.-121

 .         .         .         .         .         .                g.5121
 ttcctcgccaggacggacgcacttccggcggatgtgggggccagccctcggaaacggaag       c.-61

 .         .         .         .         .         .                g.5181
 tgagcggcggggtcgactgacggtaacggggcagagaggctgttcgcagagctgcggaag       c.-1

     | 02    .         .         .         .         .         .    g.8463
 ATG | AATGCCAGAGGACTTGGATCTGAGCTAAAGGACAGTATTCCAGTTACTGAACTTTCA    c.60
 M   | N  A  R  G  L  G  S  E  L  K  D  S  I  P  V  T  E  L  S      p.20

          .         .         .         .  | 03      .         .    g.10524
 GCAAGTGGACCTTTTGAAAGTCATGATCTTCTTCGGAAAGG | TTTTTCTTGTGTGAAAAAT    c.120
 A  S  G  P  F  E  S  H  D  L  L  R  K  G  |  F  S  C  V  K  N      p.40

          .         .         .         .   | 04     .         .    g.14487
 GAACTTTTGCCTAGTCATCCCCTTGAATTATCAGAAAAAAAT | TTCCAGCTCAACCAAGAT    c.180
 E  L  L  P  S  H  P  L  E  L  S  E  K  N   | F  Q  L  N  Q  D      p.60

          .         .         .         .         .         .       g.14547
 AAAATGAATTTTTCCACACTGAGAAACATTCAGGGTCTATTTGCTCCGCTAAAATTACAG       c.240
 K  M  N  F  S  T  L  R  N  I  Q  G  L  F  A  P  L  K  L  Q         p.80

          .         .     | 05   .         .         .         .    g.18371
 ATGGAATTCAAGGCAGTGCAGCAG | GTTCAGCGTCTTCCATTTCTTTCAAGCTCAAATCTT    c.300
 M  E  F  K  A  V  Q  Q   | V  Q  R  L  P  F  L  S  S  S  N  L      p.100

          .         .         .         .         .         | 06    g.24033
 TCACTGGATGTTTTGAGGGGTAATGATGAGACTATTGGATTTGAGGATATTCTTAATG | AT    c.360
 S  L  D  V  L  R  G  N  D  E  T  I  G  F  E  D  I  L  N  D |       p.120

          .         .         .         .         .         .       g.24093
 CCATCACAAAGCGAAGTCATGGGAGAGCCACACTTGATGGTGGAATATAAACTTGGTTTA       c.420
 P  S  Q  S  E  V  M  G  E  P  H  L  M  V  E  Y  K  L  G  L         p.140

                                                                    g.24099
 CTGTAA                                                             c.426
 L  X                                                               p.141

          .         .         .         .         .         .       g.24159
 tagtgtgctgttcatggaaaccgagggctgcatcttgtttatagtcatctttgtactgta       c.*60

          .         .         .         .         .         .       g.24219
 atttgatgtacacaacattaaaagtactgacacctgagaatttctgctcaagtagtatca       c.*120

          .         .         .         .         .         .       g.24279
 gtgatcatttaaaatttggaggggtctttggtttacagccatgtgacaattaaaagcact       c.*180

          .         .         .         .         .         .       g.24339
 aaagggagatcatgttaaagctcttaatttatattaaaacagtagcctttgtctttaaaa       c.*240

          .         .         .         .         .         .       g.24399
 aagttgttgctcatgaatattataaaatgatctacaggtttcaattcaacctgtttctag       c.*300

          .         .         .         .         .         .       g.24459
 gtttttttgtaaatttagttttgattaagcattataagcatttgagtctataaactttat       c.*360

          .         .         .         .         .         .       g.24519
 agtagcatctttcagaataaacatttttaattgatttcagtggcaactctcaaattgatt       c.*420

          .         .         .         .         .         .       g.24579
 acaatatgagatatatcagtgtcgtccattaacactcataagaataatatttactgtgtc       c.*480

          .         .         .         .         .         .       g.24639
 agtgctattttaggattatagttattgtttgattatttcaggttgaaaagtagaagttcc       c.*540

          .         .         .         .         .         .       g.24699
 aaggttttgattttggtctggtctttaagtgaaaaattaaagcaaccagtagatgtaggt       c.*600

          .         .         .         .         .         .       g.24759
 taaacttttacttcatagacttaatatgtaattaatatattgccaagcaacactgttaaa       c.*660

          .         .         .         .         .         .       g.24819
 gaaaagtaaaactcattttttcttgttcttaatttatatattacaagatactgtaaggta       c.*720

          .         .         .         .         .         .       g.24879
 ttctttatgaagttgatatataaaaatttacatttttagaacattagtgaatggatcatc       c.*780

          .         .         .         .         .         .       g.24939
 ttttacaattaaaagtatattttgattatcagtttcttaggaacatctttgattagataa       c.*840

          .                                                         g.24954
 attactgatttgaaa                                                    c.*855

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Proteasome maturation protein protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.