peptidylprolyl isomerase (cyclophilin)-like 1 (PPIL1) - coding DNA reference sequence

(used for variant description)

(last modified November 1, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_016059.4 in the PPIL1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000006.11, covering PPIL1 transcript NM_016059.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5012
                                                 cggtatcgccac       c.-241

 .         .         .         .         .         .                g.5072
 ttggagaccaccgcgaatgaagtttgcattttcctctgttcttgagcccagcttcttctc       c.-181

 .         .         .         .         .         .                g.5132
 gtctcccaccccagcttcccggcattggaagaagggaccgtcctcttccttgtcttggcc       c.-121

 .         .         .         .         .         .                g.5192
 acccaaatcctggtatcgaaagggttgaacggaccggaagtgtgcagcagcgacgggtcc       c.-61

 .         .         .         .         .         .                g.5252
 ccagctaatcgacgccggaagtagcaattactagacaagcattccgccgccggcttcgct       c.-1

          .         .         .         .         .       | 02 .    g.8156
 ATGGCGGCAATTCCCCCAGATTCCTGGCAGCCACCCAACGTTTACTTGGAGACCAG | CATG    c.60
 M  A  A  I  P  P  D  S  W  Q  P  P  N  V  Y  L  E  T  S  |  M      p.20

          .         .         .         .         .         .       g.8216
 GGAATCATTGTGCTGGAGCTGTACTGGAAGCATGCTCCAAAGACCTGTAAGAACTTTGCT       c.120
 G  I  I  V  L  E  L  Y  W  K  H  A  P  K  T  C  K  N  F  A         p.40

          .         .         .         .         .         .       g.8276
 GAGTTGGCTCGTCGAGGTTACTACAATGGCACAAAATTCCACAGAATTATCAAAGACTTC       c.180
 E  L  A  R  R  G  Y  Y  N  G  T  K  F  H  R  I  I  K  D  F         p.60

          .         .         .  | 03      .         .         .    g.23399
 ATGATCCAAGGAGGTGACCCAACAGGGACAG | GTCGAGGTGGTGCATCTATCTATGGCAAA    c.240
 M  I  Q  G  G  D  P  T  G  T  G |   R  G  G  A  S  I  Y  G  K      p.80

          .         .         .         . | 04       .         .    g.24011
 CAGTTTGAAGATGAACTTCATCCAGACTTGAAATTCACGG | GGGCTGGAATTCTCGCAATG    c.300
 Q  F  E  D  E  L  H  P  D  L  K  F  T  G |   A  G  I  L  A  M      p.100

          .         .         .         .         .         .       g.24071
 GCCAATGCGGGGCCAGATACCAATGGCAGCCAGTTCTTTGTGACCCTCGCCCCCACCCAG       c.360
 A  N  A  G  P  D  T  N  G  S  Q  F  F  V  T  L  A  P  T  Q         p.120

          .         .         .         .         .         .       g.24131
 TGGCTTGACGGCAAACACACCATTTTTGGCCGAGTGTGTCAGGGCATAGGAATGGTGAAT       c.420
 W  L  D  G  K  H  T  I  F  G  R  V  C  Q  G  I  G  M  V  N         p.140

          .         .         .         .         .         .       g.24191
 CGCGTGGGAATGGTAGAAACAAACTCCCAGGACCGCCCTGTGGACGACGTGAAGATCATT       c.480
 R  V  G  M  V  E  T  N  S  Q  D  R  P  V  D  D  V  K  I  I         p.160

          .         .                                               g.24212
 AAGGCATACCCTTCTGGGTAG                                              c.501
 K  A  Y  P  S  G  X                                                p.166

          .         .         .         .         .         .       g.24272
 acttgctaccctcttgagcagctcttctgagatggccccagtgaaccagcttctagatga       c.*60

          .         .         .         .         .         .       g.24332
 catagaatgacatgtaatgctaaattcattttggctttgcaagtcatgaagcttaggagg       c.*120

          .         .         .         .         .         .       g.24392
 cctggcatcttgggtgagttagagatggaagtacattttaataggatgcttcttttctct       c.*180

          .         .         .         .         .         .       g.24452
 tcccccagtgcctaggttgccagagcatttgcacaaatgcccctgtttatcaataggtga       c.*240

          .         .         .         .         .         .       g.24512
 ctacttactacacatgaaccataatgctgcttcttgtgcatgtctgctctgatatacgtc       c.*300

          .         .         .         .         .         .       g.24572
 gaacaatgtagcagccactgtcatttctcagtggttttgcctaaccaaacttcttcctaa       c.*360

          .         .         .         .         .         .       g.24632
 ggagatttatattctggcctacacagcagtccttgatggctgacagccacagaattccaa       c.*420

          .         .         .         .         .         .       g.24692
 accaagtagtgtctgtcagccctcttaactctgtgcacgccctatttcagtcttttacat       c.*480

          .         .         .         .         .         .       g.24752
 ttgttcttctagggaatgtatgcatctctatatatattttccctctcaaaaccagaacat       c.*540

          .         .         .         .         .         .       g.24812
 caacagtgctgtttctgacacttcagacatcccacgcaaagccacattgaatttttgcca       c.*600

          .         .         .         .         .         .       g.24872
 aatgaaaaacacatccaacaatcaagtttctaagaaggtgtcaagtggggaataataata       c.*660

          .         .         .         .         .         .       g.24932
 atgtataataatcaagaaattagtttattaaaaggaagcagaagcattgaccattttttc       c.*720

          .         .         .         .         .         .       g.24992
 ccagagaagaggagaaatctgtagtgagcaaaggacagaccatgaatcctccttgagaag       c.*780

          .         .         .         .         .         .       g.25052
 tagtactctcagaaaggagaagcgccactcaagttcttttaacccaagactttagagaaa       c.*840

          .         .         .         .         .         .       g.25112
 ttaggtccaagatttttatatgttcagttgtttatgtataaaaataactttctggatttt       c.*900

          .         .         .         .         .         .       g.25172
 gtggggaggagcaggagaggaaggaagttaatacctatgtaatacatagaaacttccaca       c.*960

          .         .                                               g.25196
 ataaaatgccattgatggttgaaa                                           c.*984

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Peptidylprolyl isomerase (cyclophilin)-like 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.