protein phosphatase 2, regulatory subunit B, beta (PPP2R2B) - coding DNA reference sequence

(used for variant description)

(last modified August 6, 2019)


This file was created to facilitate the description of sequence variants on transcript NM_181678.2 in the PPP2R2B gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011570.1, covering PPP2R2B transcript NM_181678.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5035
                          agtcacacaggggatgactgcaagtccttcgtaac       c.-241

 .         .         .         .         .         .                g.5095
 cactccaggacgctgccagggcctgagaagggacaaactccaattgctccagttcaaact       c.-181

 .         .         .         .         .         .    | 02        g.5340
 ggtcctggcctggtcaaacggaggagacagagcagtgattcacagcaggacgtg | gaattg    c.-121

 .         .         .         .         .         .                g.5400
 ggacactcacccaggacacactatggtgcttcagccaagtgaaaggcactatcgagattg       c.-61

 .         .  | 03      .         .         .         .             g.229935
 gaaccacagaag | gagccaagggagaacccaagacagagaatagtggcccaataatgaagc    c.-1

          .         .         .        | 04.         .         .    g.385351
 ATGAATTATCCAGATGAAAACACCTATGGAAATAAAG | CTGACATTATCTCTACGGTAGAA    c.60
 M  N  Y  P  D  E  N  T  Y  G  N  K  A |   D  I  I  S  T  V  E      p.20

          .         .         .         .         .         .       g.385411
 TTCAACCACACGGGAGAATTACTAGCGACAGGGGACAAGGGGGGTCGGGTTGTAATATTT       c.120
 F  N  H  T  G  E  L  L  A  T  G  D  K  G  G  R  V  V  I  F         p.40

          .      | 05  .         .         .         .         .    g.388371
 CAACGAGAGCAGGAG | AGTAAAAATCAGGTTCATCGTAGGGGTGAATACAATGTTTACAGC    c.180
 Q  R  E  Q  E   | S  K  N  Q  V  H  R  R  G  E  Y  N  V  Y  S      p.60

          .         .         .         .         .         .       g.388431
 ACATTCCAGAGCCATGAACCCGAGTTCGATTACCTGAAGAGTTTAGAAATAGAAGAAAAA       c.240
 T  F  Q  S  H  E  P  E  F  D  Y  L  K  S  L  E  I  E  E  K         p.80

          .         .         .         .         .         .       g.388491
 ATCAATAAAATAAGATGGCTCCCCCAGCAGAATGCAGCTTACTTTCTTCTGTCTACTAAT       c.300
 I  N  K  I  R  W  L  P  Q  Q  N  A  A  Y  F  L  L  S  T  N         p.100

   | 06      .         .         .         .         .         .    g.395289
 G | ATAAAACTGTGAAGCTGTGGAAAGTCAGCGAGCGTGATAAGAGGCCAGAAGGCTACAAT    c.360
 D |   K  T  V  K  L  W  K  V  S  E  R  D  K  R  P  E  G  Y  N      p.120

          .         .         .         .         .     | 07   .    g.435752
 CTGAAAGATGAGGAGGGCCGGCTCCGGGATCCTGCCACCATCACAACCCTGCGG | GTGCCT    c.420
 L  K  D  E  E  G  R  L  R  D  P  A  T  I  T  T  L  R   | V  P      p.140

          .         .         .         .         .         .       g.435812
 GTCCTGAGACCCATGGACCTGATGGTGGAGGCCACCCCACGAAGAGTATTTGCCAACGCA       c.480
 V  L  R  P  M  D  L  M  V  E  A  T  P  R  R  V  F  A  N  A         p.160

          .         .         .         .         .         .       g.435872
 CACACATATCACATCAACTCCATATCTGTCAACAGCGACTATGAAACCTACATGTCCGCT       c.540
 H  T  Y  H  I  N  S  I  S  V  N  S  D  Y  E  T  Y  M  S  A         p.180

          .         .         .         .         .   | 08     .    g.448063
 GATGACCTGAGGATTAACCTATGGAACTTTGAAATAACCAATCAAAGTTTTA | ATATTGTG    c.600
 D  D  L  R  I  N  L  W  N  F  E  I  T  N  Q  S  F  N |   I  V      p.200

          .         .         .         .         .         .       g.448123
 GACATTAAGCCAGCCAACATGGAGGAGCTCACGGAGGTGATCACAGCAGCCGAGTTCCAC       c.660
 D  I  K  P  A  N  M  E  E  L  T  E  V  I  T  A  A  E  F  H         p.220

          .         .         .         .         .         .       g.448183
 CCCCATCATTGCAACACCTTCGTGTACAGCAGCAGCAAAGGGACAATCCGGCTGTGTGAC       c.720
 P  H  H  C  N  T  F  V  Y  S  S  S  K  G  T  I  R  L  C  D         p.240

          .         .         .        | 09.         .         .    g.486033
 ATGCGGGCATCTGCCCTGTGTGACAGGCACACCAAAT | TTTTTGAAGAGCCGGAAGATCCA    c.780
 M  R  A  S  A  L  C  D  R  H  T  K  F |   F  E  E  P  E  D  P      p.260

          .         .         .         .         .         .       g.486093
 AGCAACAGATCATTTTTCTCTGAAATTATCTCTTCGATTTCGGATGTGAAGTTCAGCCAC       c.840
 S  N  R  S  F  F  S  E  I  I  S  S  I  S  D  V  K  F  S  H         p.280

          .         .         .         .         .         .       g.486153
 AGTGGGAGGTATATCATGACCAGGGACTACTTGACCGTCAAAGTCTGGGATCTCAACATG       c.900
 S  G  R  Y  I  M  T  R  D  Y  L  T  V  K  V  W  D  L  N  M         p.300

          .         .        | 10.         .         .         .    g.493441
 GAAAACCGCCCCATCGAGACTTACCAG | GTTCATGACTACCTCCGCAGCAAGCTGTGTTCC    c.960
 E  N  R  P  I  E  T  Y  Q   | V  H  D  Y  L  R  S  K  L  C  S      p.320

          .         .         .         .         .          | 11    g.496245
 CTCTATGAAAATGACTGCATTTTTGATAAATTTGAGTGTGTGTGGAATGGGTCAGACAG | T    c.1020
 L  Y  E  N  D  C  I  F  D  K  F  E  C  V  W  N  G  S  D  S  |      p.340

          .         .         .         .         .         .       g.496305
 GTCATCATGACAGGCTCCTACAACAACTTCTTCAGGATGTTCGACAGAAACACCAAGCGT       c.1080
 V  I  M  T  G  S  Y  N  N  F  F  R  M  F  D  R  N  T  K  R         p.360

          .         .         .         .         .         .       g.496365
 GATGTGACCCTTGAGGCTTCGAGGGAAAACAGCAAGCCCCGGGCTATCCTCAAACCCCGA       c.1140
 D  V  T  L  E  A  S  R  E  N  S  K  P  R  A  I  L  K  P  R         p.380

          .         .         .         .         .         .       g.496425
 AAAGTGTGTGTGGGGGGCAAGCGGAGAAAAGACGAGATCAGTGTCGACAGTCTGGACTTT       c.1200
 K  V  C  V  G  G  K  R  R  K  D  E  I  S  V  D  S  L  D  F         p.400

          .         .         .         .         .         .       g.496485
 AGCAAAAAGATCTTGCATACAGCTTGGCATCCTTCAGAAAATATTATAGCAGTGGCGGCT       c.1260
 S  K  K  I  L  H  T  A  W  H  P  S  E  N  I  I  A  V  A  A         p.420

          .         .         .                                     g.496524
 ACAAATAACCTATATATATTCCAGGACAAGGTTAACTAG                            c.1299
 T  N  N  L  Y  I  F  Q  D  K  V  N  X                              p.432

          .         .         .         .         .         .       g.496584
 gtggacaagttattacttaataatctcacatactgaatactagtcaaacaagtttttaaa       c.*60

          .         .         .         .         .         .       g.496644
 tgtttctttgggtcttcatttgatgcattgactttaatttccctatacaggaaatgattg       c.*120

          .         .         .         .         .         .       g.496704
 gaatagaattaaaaggagtccaacattcccagctccccagttctaagaaacttttgtcaa       c.*180

          .         .         .         .         .         .       g.496764
 acccaataggtttgggacacttctgtttagaattgaaagctgccagctaacagtaattct       c.*240

          .         .         .         .         .         .       g.496824
 tccatagttgacttgaacttctgatgcttttattgcccagttttctctggtgggtccagt       c.*300

          .         .         .         .         .         .       g.496884
 gttttgttcctaggtgtctgctgcgataaaatgaggttgtctgtagtatttaaggagaaa       c.*360

          .         .         .         .         .         .       g.496944
 agagataagttttttttaattaagcaattccatttgattgaaaaaaatcaacaaaaaata       c.*420

          .         .                                               g.496967
 aacaccgtttactcttagacaaa                                            c.*443

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Protein phosphatase 2, regulatory subunit B, beta protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center