progressive rod-cone degeneration (PRCD) - coding DNA reference sequence

(used for variant description)

(last modified January 31, 2017)

This file was created to facilitate the description of sequence variants on transcript NM_001077620.2 in the PRCD gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_016702.1, covering PRCD transcript NM_001077620.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.17496
                  aggacagacggcagtggctcctgagagctggctggggccattt       c.-61

 .         .         .         .         .         .                g.17556
 tggcccctcgcctgtggccttctgcagacttggcctgggaggggatggggcagctgcgcc       c.-1

          .         .         .         .         .         .       g.17616
 ATGTGCACCACCCTTTTCCTGCTCAGCACCCTGGCCATGCTCTGGCGCCGCCGATTTGCC       c.60
 M  C  T  T  L  F  L  L  S  T  L  A  M  L  W  R  R  R  F  A         p.20

          .     | 02   .         .         .         .         .    g.17965
 AACCGAGTCCAACC | AGAGCCCAGCGACGTGGATGGGGCAGCTAGGGGCAGCAGCTTGGAT    c.120
 N  R  V  Q  P  |  E  P  S  D  V  D  G  A  A  R  G  S  S  L  D      p.40

          .         .    | 03    .         .                        g.20004
 GCGGACCCTCAGTCCTCAGGCAG | GGAGAAAGAACCTCTGAAGTAA                   c.165
 A  D  P  Q  S  S  G  R  |  E  K  E  P  L  K  X                     p.54

          .         .         .         .         .          | 04    g.20459
 gccctcacctctgcaggtggggctcaggcccagagactgggatcagctggctcaggcag | c    c.*60

          .         .         .         .         .         .       g.20519
 tcaggtcctggttcgtcccctagcccaggaggatgctgtgggagctgcagcagcggcaag       c.*120

          .         .         .   | 05     .         .         .    g.21260
 agggagaatggggggaagcagcactagagaag | ttcccagagctcatcctgtcactggctg    c.*180

          .         .         .         .         .         .       g.21320
 ctctgctgaaattatcaataagaaatgccagttggatctgtgacatgtctgcctgcagct       c.*240

          .         .         .         .         .         .       g.21380
 ggatgggagcaacggacagcttgtcctccgaatgtgttttctgtatgtgtgcaagcgcgt       c.*300

          .         .         .         .         .         .       g.21440
 gtgttccaaacgggcagtagcgtgtgggaaggaaaaagcctgacacttgtttttatcaat       c.*360

          .         .         .         .         .         .       g.21500
 ttgctgatgctcagtcccggcggctgcctcctttgcccccagctgctctgccatttctct       c.*420

          .         .         .         .         .         .       g.21560
 cttttcaatcctgcatgatcctgagcagagataaaagcagatttccgcttctgctcccag       c.*480

          .         .         .         .         .         .       g.21620
 atccaggagcagaccctgcaggcagctgctcctgatgtctcacagctattagtcttcaaa       c.*540

          .         .         .         .         .         .       g.21680
 aaccccccgtgcctctgtgcacacgcgtctctcctccccagccagcccccctcccagccc       c.*600

          .         .         .         .         .         .       g.21740
 agcggcgatgtctctgcctggctggcccgtgcccttgacttccaggcagtagaagatgga       c.*660

          .         .         .         .         .         .       g.21800
 gttctctagacagcagcacttcagccgccactctgcctctgaagggaaggaagggaaagg       c.*720

          .         .         .         .         .         .       g.21860
 gtgagggatgccgcagagcagagggaaccgctggggaggcgctcagggtgggggaggagg       c.*780

          .         .         .         .         .         .       g.21920
 tgcaccccgctggggagggcctgctggtacctcggggagcctggctggggtgtgtgcgaa       c.*840

          .         .         .         .         .         .       g.21980
 ggcagttctgtgggagcctctcaaagtagggcaggcaggaggcagggggaaagtcacact       c.*900

          .         .         .         .         .         .       g.22040
 agggaaggagcctgcagaggcaaagccagagcgccagcctgacccaggccgtgagcccgt       c.*960

          .         .         .         .         .         .       g.22100
 gatcgcctgtctcagctcctgtcagcctgtctctctctttggaggcatcggccttcctgg       c.*1020

          .         .         .         .         .         .       g.22160
 tgacaggcctgtcaggctgagggccagagggcactgttcccgggacccagtctgtgttcc       c.*1080

          .         .         .         .         .         .       g.22220
 ccgatcctatctgcatttattctctatttgccatgttcctgtcacctcatccttgctgcc       c.*1140

          .         .         .         .         .         .       g.22280
 atttccgagttgctcatctccttccactggtctgaggaattgtcaggccaaggtcatgga       c.*1200

          .         .         .         .         .         .       g.22340
 gctggctcacggcccagacgcacttccccagggcagcgcccctccacgccactgttccga       c.*1260

          .         .         .         .         .         .       g.22400
 gaacctgcgcaggaggtggtggctgctccagggatccatccagaggaagggcgggaaaaa       c.*1320

          .         .         .         .         .         .       g.22460
 gagaggaaggggctgctggcggccagcggggctgtggctgcctgggcttggaggttgcct       c.*1380

          .         .         .         .         .         .       g.22520
 gggcagctggggtgccatgtgggccgggtgggggggctgtctcccccagggagcaggctg       c.*1440

          .         .         .         .         .         .       g.22580
 gctttggtgggagcagattgtgtttacaccttccccgcacacccagcccacgctcgcctc       c.*1500

          .         .         .         .         .         .       g.22640
 ttattcccggggcctctcccacccctgggctctctgcgcagtctgcacatttgcagctcc       c.*1560

          .         .         .         .         .         .       g.22700
 tgctgcagaaagttacctctctcagcctagagctccccacagaaggctcctgggacccgg       c.*1620

          .         .         .         .         .         .       g.22760
 gtgccccttccttggcccactggctcccatcacagggcttagtgtgaagctcagggcaag       c.*1680

          .         .         .         .                           g.22806
 ggtggacctttaaatgggggaattaaatcctgactatgacactgtc                     c.*1726

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Progressive rod-cone degeneration protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.