prion protein (PRNP) - coding DNA reference sequence

(used for variant description)

(last modified September 16, 2013)

This file was created to facilitate the description of sequence variants on transcript NM_000311.3 in the PRNP gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009087.1, covering PRNP transcript NM_000311.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5012
                                                 attaaagatgat       c.-361

 .         .         .         .         .         .                g.5072
 ttttacagtcaatgagccacgtcagggagcgatggcacccgcaggcggtatcaactgatg       c.-301

 .         .         .         .         .         .                g.5132
 caagtgttcaagcgaatctcaactcgttttttccggtgactcattcccggccctgcttgg       c.-241

 .         .         .         .         .         .                g.5192
 cagcgctgcaccctttaacttaaacctcggccggccgcccgccgggggcacagagtgtgc       c.-181

 .         .         .         .         .         .                g.5252
 gccgggccgcgcggcaattggtccccgcgccgacctccgcccgcgagcgccgccgcttcc       c.-121

 .         .         .         .         .         .                g.5312
 cttccccgccccgcgtccctccccctcggccccgcgcgtcgcctgtcctccgagccagtc       c.-61

 .         .         .         .         .          | 02            g.18070
 gctgacagccgcggcgccgcgagcttctcctctcctcacgaccgaggcag | agcagtcatt    c.-1

          .         .         .         .         .         .       g.18130
 ATGGCGAACCTTGGCTGCTGGATGCTGGTTCTCTTTGTGGCCACATGGAGTGACCTGGGC       c.60
 M  A  N  L  G  C  W  M  L  V  L  F  V  A  T  W  S  D  L  G         p.20

          .         .         .         .         .         .       g.18190
 CTCTGCAAGAAGCGCCCGAAGCCTGGAGGATGGAACACTGGGGGCAGCCGATACCCGGGG       c.120
 L  C  K  K  R  P  K  P  G  G  W  N  T  G  G  S  R  Y  P  G         p.40

          .         .         .         .         .         .       g.18250
 CAGGGCAGCCCTGGAGGCAACCGCTACCCACCTCAGGGCGGTGGTGGCTGGGGGCAGCCT       c.180
 Q  G  S  P  G  G  N  R  Y  P  P  Q  G  G  G  G  W  G  Q  P         p.60

          .         .         .         .         .         .       g.18310
 CATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCCCATGGTGGTGGC       c.240
 H  G  G  G  W  G  Q  P  H  G  G  G  W  G  Q  P  H  G  G  G         p.80

          .         .         .         .         .         .       g.18370
 TGGGGACAGCCTCATGGTGGTGGCTGGGGTCAAGGAGGTGGCACCCACAGTCAGTGGAAC       c.300
 W  G  Q  P  H  G  G  G  W  G  Q  G  G  G  T  H  S  Q  W  N         p.100

          .         .         .         .         .         .       g.18430
 AAGCCGAGTAAGCCAAAAACCAACATGAAGCACATGGCTGGTGCTGCAGCAGCTGGGGCA       c.360
 K  P  S  K  P  K  T  N  M  K  H  M  A  G  A  A  A  A  G  A         p.120

          .         .         .         .         .         .       g.18490
 GTGGTGGGGGGCCTTGGCGGCTACATGCTGGGAAGTGCCATGAGCAGGCCCATCATACAT       c.420
 V  V  G  G  L  G  G  Y  M  L  G  S  A  M  S  R  P  I  I  H         p.140

          .         .         .         .         .         .       g.18550
 TTCGGCAGTGACTATGAGGACCGTTACTATCGTGAAAACATGCACCGTTACCCCAACCAA       c.480
 F  G  S  D  Y  E  D  R  Y  Y  R  E  N  M  H  R  Y  P  N  Q         p.160

          .         .         .         .         .         .       g.18610
 GTGTACTACAGGCCCATGGATGAGTACAGCAACCAGAACAACTTTGTGCACGACTGCGTC       c.540
 V  Y  Y  R  P  M  D  E  Y  S  N  Q  N  N  F  V  H  D  C  V         p.180

          .         .         .         .         .         .       g.18670
 AATATCACAATCAAGCAGCACACGGTCACCACAACCACCAAGGGGGAGAACTTCACCGAG       c.600
 N  I  T  I  K  Q  H  T  V  T  T  T  T  K  G  E  N  F  T  E         p.200

          .         .         .         .         .         .       g.18730
 ACCGACGTTAAGATGATGGAGCGCGTGGTTGAGCAGATGTGTATCACCCAGTACGAGAGG       c.660
 T  D  V  K  M  M  E  R  V  V  E  Q  M  C  I  T  Q  Y  E  R         p.220

          .         .         .         .         .         .       g.18790
 GAATCTCAGGCCTATTACCAGAGAGGATCGAGCATGGTCCTCTTCTCCTCTCCACCTGTG       c.720
 E  S  Q  A  Y  Y  Q  R  G  S  S  M  V  L  F  S  S  P  P  V         p.240

          .         .         .         .                           g.18832
 ATCCTCCTGATCTCTTTCCTCATCTTCCTGATAGTGGGATGA                         c.762
 I  L  L  I  S  F  L  I  F  L  I  V  G  X                           p.253

          .         .         .         .         .         .       g.18892
 ggaaggtcttcctgttttcaccatctttctaatctttttccagcttgagggaggcggtat       c.*60

          .         .         .         .         .         .       g.18952
 ccacctgcagcccttttagtggtggtgtctcactctttcttctctctttgtcccggatag       c.*120

          .         .         .         .         .         .       g.19012
 gctaatcaatacccttggcactgatgggcactggaaaacatagagtagacctgagatgct       c.*180

          .         .         .         .         .         .       g.19072
 ggtcaagccccctttgattgagttcatcatgagccgttgctaatgccaggccagtaaaag       c.*240

          .         .         .         .         .         .       g.19132
 tataacagcaaataaccattggttaatctggacttatttttggacttagtgcaacaggtt       c.*300

          .         .         .         .         .         .       g.19192
 gaggctaaaacaaatctcagaacagtctgaaatacctttgcctggatacctctggctcct       c.*360

          .         .         .         .         .         .       g.19252
 tcagcagctagagctcagtatactaatgccctatcttagtagagatttcatagctattta       c.*420

          .         .         .         .         .         .       g.19312
 gagatattttccattttaagaaaacccgacaacatttctgccaggtttgttaggaggcca       c.*480

          .         .         .         .         .         .       g.19372
 catgatacttattcaaaaaaatcctagagattcttagctcttgggatgcaggctcagccc       c.*540

          .         .         .         .         .         .       g.19432
 gctggagcatgagctctgtgtgtaccgagaactggggtgatgttttacttttcacagtat       c.*600

          .         .         .         .         .         .       g.19492
 gggctacacagcagctgttcaacaagagtaaatattgtcacaacactgaacctctggcta       c.*660

          .         .         .         .         .         .       g.19552
 gaggacatattcacagtgaacataactgtaacatatatgaaaggcttctgggacttgaaa       c.*720

          .         .         .         .         .         .       g.19612
 tcaaatgtttgggaatggtgcccttggaggcaacctcccattttagatgtttaaaggacc       c.*780

          .         .         .         .         .         .       g.19672
 ctatatgtggcattcctttctttaaactataggtaattaaggcagctgaaaagtaaattg       c.*840

          .         .         .         .         .         .       g.19732
 ccttctagacactgaaggcaaatctcctttgtccatttacctggaaaccagaatgatttt       c.*900

          .         .         .         .         .         .       g.19792
 gacatacaggagagctgcagttgtgaaagcaccatcatcatagaggatgatgtaattaaa       c.*960

          .         .         .         .         .         .       g.19852
 aaatggtcagtgtgcaaagaaaagaactgcttgcatttctttatttctgtctcataattg       c.*1020

          .         .         .         .         .         .       g.19912
 tcaaaaaccagaattaggtcaagttcatagtttctgtaattggcttttgaatcaaagaat       c.*1080

          .         .         .         .         .         .       g.19972
 agggagacaatctaaaaaatatcttaggttggagatgacagaaatatgattgatttgaag       c.*1140

          .         .         .         .         .         .       g.20032
 tggaaaaagaaattctgttaatgttaattaaagtaaaattattccctgaattgtttgata       c.*1200

          .         .         .         .         .         .       g.20092
 ttgtcacctagcagatatgtattacttttctgcaatgttattattggcttgcactttgtg       c.*1260

          .         .         .         .         .         .       g.20152
 agtattctatgtaaaaatatatatgtatataaaatatatattgcataggacagacttagg       c.*1320

          .         .         .         .         .         .       g.20212
 agttttgtttagagcagttaacatctgaagtgtctaatgcattaacttttgtaaggtact       c.*1380

          .         .         .         .         .         .       g.20272
 gaatacttaatatgtgggaaacccttttgcgtggtccttaggcttacaatgtgcactgaa       c.*1440

          .         .         .         .         .         .       g.20332
 tcgtttcatgtaagaatccaaagtggacaccattaacaggtctttgaaatatgcatgtac       c.*1500

          .         .         .         .         .         .       g.20392
 tttatattttctatatttgtaactttgcatgttcttgttttgttatataaaaaaattgta       c.*1560

          .         .         .         .                           g.20438
 aatgtttaatatctgactgaaattaaacgagcgaagatgagcacca                     c.*1606

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Prion protein protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.