prokineticin 2 (PROK2) - coding DNA reference sequence

(used for variant description)

(last modified October 21, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_001126128.1 in the PROK2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008275.1, covering PROK2 transcript NM_001126128.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5034
                           gccggcgtgagtcacggcggggctagcctttata       c.-121

 .         .         .         .         .         .                g.5094
 acggcccggaggctcgcgggagccgccgcgcccgtccgcccgccgctccgcgctccaccc       c.-61

 .         .         .         .         .         .                g.5154
 agcgcacccgggccccgcgcccccaactgcctccggcggccgcccagtcccgagggcgcc       c.-1

          .         .         .         .         .         .       g.5214
 ATGAGGAGCCTGTGCTGCGCCCCACTCCTGCTCCTCTTGCTGCTGCCGCCGCTGCTGCTC       c.60
 M  R  S  L  C  C  A  P  L  L  L  L  L  L  L  P  P  L  L  L         p.20

          .         .         .       | 02 .         .         .    g.8638
 ACGCCCCGCGCTGGGGACGCCGCCGTGATCACCGGG | GCTTGTGACAAGGACTCCCAATGT    c.120
 T  P  R  A  G  D  A  A  V  I  T  G   | A  C  D  K  D  S  Q  C      p.40

          .         .         .         .         .         .       g.8698
 GGTGGAGGCATGTGCTGTGCTGTCAGTATCTGGGTCAAGAGCATAAGGATTTGCACACCT       c.180
 G  G  G  M  C  C  A  V  S  I  W  V  K  S  I  R  I  C  T  P         p.60

          .         .         .         .   | 03     .         .    g.15717
 ATGGGCAAACTGGGAGACAGCTGCCATCCACTGACTCGTAAA | AACAATTTTGGAAATGGA    c.240
 M  G  K  L  G  D  S  C  H  P  L  T  R  K   | N  N  F  G  N  G      p.80

          .         .         .         .      | 04  .         .    g.17393
 AGGCAGGAAAGAAGAAAGAGGAAGAGAAGCAAAAGGAAAAAGGAG | GTTCCATTTTTTGGG    c.300
 R  Q  E  R  R  K  R  K  R  S  K  R  K  K  E   | V  P  F  F  G      p.100

          .         .         .         .         .         .       g.17453
 CGGAGGATGCATCACACTTGCCCATGTCTGCCAGGCTTGGCCTGTTTACGGACTTCATTT       c.360
 R  R  M  H  H  T  C  P  C  L  P  G  L  A  C  L  R  T  S  F         p.120

          .         .         .                                     g.17483
 AACCGATTTATTTGTTTAGCCCAAAAGTAA                                     c.390
 N  R  F  I  C  L  A  Q  K  X                                       p.129

          .         .         .         .         .         .       g.17543
 tcgctctggagtagaaaccaaatgtgaatagccacatcttacctgtaaagtcttacttgt       c.*60

          .         .         .         .         .         .       g.17603
 gattgtgccaaacaaaaaatgtgccagaaagaaatgctcttgcttcctcaactttccaag       c.*120

          .         .         .         .         .         .       g.17663
 taacatttttatctttgatttgtaaatgatttttttttttttttatcgaaagagaatttt       c.*180

          .         .         .         .         .         .       g.17723
 acttttggatagaaatatgaagtgtaaggcattatggaactggttcttatttccctgttt       c.*240

          .         .         .         .         .         .       g.17783
 gtgttttggtttgatttggcttttttcttaaatgtcaaaaacgtacccattttcacaaaa       c.*300

          .         .         .         .         .         .       g.17843
 atgaggaaaataagaatttgatattttgttagaaaaacttttttttttttttctcaccac       c.*360

          .         .         .         .         .         .       g.17903
 cccaagccccatttgtgccctgccacacaaatacacctacagcttttggtcccttgcctc       c.*420

          .         .         .         .         .         .       g.17963
 ttccacctcaaagaatttcaaggctcttaccttactttatttttgtccatttctcttccc       c.*480

          .         .         .         .         .         .       g.18023
 tcctcttgcattttaaagtggagggtttgtctctttgagtttgatggcagaatcactgat       c.*540

          .         .         .         .         .         .       g.18083
 gggaatccagctttttgctggcatttaaatagtgaaaagagtgtatatgtgaacttgaca       c.*600

          .         .         .         .         .         .       g.18143
 ctccaaactcctgtcatggcacggaagctaggagtgctgctggacccttcctaaacctgt       c.*660

          .         .         .         .         .         .       g.18203
 cactcaagaggacttcagctctgctgttgggctggtgtgtggacagaaggaatggaaagc       c.*720

          .         .         .         .         .         .       g.18263
 caaattaatttagtccagatttctaggtttgggtttttctaaaaataaaagattacattt       c.*780

          .         .         .         .         .         .       g.18323
 acttcttttactttttataaagttttttttccttagtctcctacttagagatattctaga       c.*840

          .         .         .         .         .         .       g.18383
 aaatgtcacttgaagaggaagtatttattttaatctggcacaacactaattaccattttt       c.*900

          .         .         .         .         .         .       g.18443
 aaagcagtattaagttgtaatttaaaccttgtttgtaactgaaaggtcgattgtaatgga       c.*960

          .         .         .         .         .         .       g.18503
 ttgccgtttgtacctgtatcagtattgctgtgtaaaaattctgtatcagaataataacag       c.*1020

          .         .         .         .                           g.18552
 tactgtatatcatttgatttattttaatattatatccttatttttgtca                  c.*1069

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Prokineticin 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.