phosphatase and tensin homolog (PTEN) - coding DNA reference sequence

(used for variant description)

(last modified September 4, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_000314.4 in the PTEN gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007466.2, covering PTEN transcript NM_000314.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5011
                                                  cctcccctcgc       c.-1021

 .         .         .         .         .         .                g.5071
 ccggcgcggtcccgtccgcctctcgctcgcctcccgcctcccctcggtcttccgaggcgc       c.-961

 .         .         .         .         .         .                g.5131
 ccgggctcccggcgcggcggcggagggggcgggcaggccggcgggcggtgatgtggcggg       c.-901

 .         .         .         .         .         .                g.5191
 actctttatgcgctgcggcaggatacgcgctcggcgctgggacgcgactgcgctcagttc       c.-841

 .         .         .         .         .         .                g.5251
 tctcctctcggaagctgcagccatgatggaagtttgagagttgagccgctgtgaggcgag       c.-781

 .         .         .         .         .         .                g.5311
 gccgggctcaggcgagggagatgagagacggcggcggccgcggcccggagcccctctcag       c.-721

 .         .         .         .         .         .                g.5371
 cgcctgtgagcagccgcgggggcagcgccctcggggagccggccggcctgcggcggcggc       c.-661

 .         .         .         .         .         .                g.5431
 agcggcggcgtttctcgcctcctcttcgtcttttctaaccgtgcagcctcttcctcggct       c.-601

 .         .         .         .         .         .                g.5491
 tctcctgaaagggaaggtggaagccgtgggctcgggcgggagccggctgaggcgcggcgg       c.-541

 .         .         .         .         .         .                g.5551
 cggcggcggcacctcccgctcctggagcgggggggagaagcggcggcggcggcggccgcg       c.-481

 .         .         .         .         .         .                g.5611
 gcggctgcagctccagggagggggtctgagtcgcctgtcaccatttccagggctgggaac       c.-421

 .         .         .         .         .         .                g.5671
 gccggagagttggtctctccccttctactgcctccaacacggcggcggcggcggcggcac       c.-361

 .         .         .         .         .         .                g.5731
 atccagggacccgggccggttttaaacctcccgtccgccgccgccgcaccccccgtggcc       c.-301

 .         .         .         .         .         .                g.5791
 cgggctccggaggccgccggcggaggcagccgttcggaggattattcgtcttctccccat       c.-241

 .         .         .         .         .         .                g.5851
 tccgctgccgccgctgccaggcctctggctgctgaggagaagcaggcccagtcgctgcaa       c.-181

 .         .         .         .         .         .                g.5911
 ccatccagcagccgccgcagcagccattacccggctgcggtccagagccaagcggcggca       c.-121

 .         .         .         .         .         .                g.5971
 gagcgaggggcatcagctaccgccaagtccagagccatttccatcctgcagaagaagccc       c.-61

 .         .         .         .         .         .                g.6031
 cgccaccagcagcttctgccatctctctcctcctttttcttcagccacaggctcccagac       c.-1

          .         .         .         .         .         .       g.6091
 ATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACAAAAGGAGATATCAAGAGGATGGA       c.60
 M  T  A  I  I  K  E  I  V  S  R  N  K  R  R  Y  Q  E  D  G         p.20

          .          | 02        .         .         .         .    g.35627
 TTCGACTTAGACTTGACCT | ATATTTATCCAAACATTATTGCTATGGGATTTCCTGCAGAA    c.120
 F  D  L  D  L  T  Y |   I  Y  P  N  I  I  A  M  G  F  P  A  E      p.40

          .         .         .         .     | 03   .         .    g.67090
 AGACTTGAAGGCGTATACAGGAACAATATTGATGATGTAGTAAG | GTTTTTGGATTCAAAG    c.180
 R  L  E  G  V  Y  R  N  N  I  D  D  V  V  R  |  F  L  D  S  K      p.60

          .         .          | 04        .         .         .    g.72638
 CATAAAAACCATTACAAGATATACAATCT | TTGTGCTGAAAGACATTATGACACCGCCAAA    c.240
 H  K  N  H  Y  K  I  Y  N  L  |  C  A  E  R  H  Y  D  T  A  K      p.80

          .    | 05    .         .         .         .         .    g.74621
 TTTAATTGCAGAG | TTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTT    c.300
 F  N  C  R  V |   A  Q  Y  P  F  E  D  H  N  P  P  Q  L  E  L      p.100

          .         .         .         .         .         .       g.74681
 ATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCA       c.360
 I  K  P  F  C  E  D  L  D  Q  W  L  S  E  D  D  N  H  V  A         p.120

          .         .         .         .         .         .       g.74741
 GCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTA       c.420
 A  I  H  C  K  A  G  K  G  R  T  G  V  M  I  C  A  Y  L  L         p.140

          .         .         .         .         .         .       g.74801
 CATCGGGGCAAATTTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACC       c.480
 H  R  G  K  F  L  K  A  Q  E  A  L  D  F  Y  G  E  V  R  T         p.160

          .   | 06     .         .         .         .         .    g.93727
 AGAGACAAAAAG | GGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTAC    c.540
 R  D  K  K   | G  V  T  I  P  S  Q  R  R  Y  V  Y  Y  Y  S  Y      p.180

          .         .         .         .         .         .       g.93787
 CTGTTAAAGAATCATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTT       c.600
 L  L  K  N  H  L  D  Y  R  P  V  A  L  L  F  H  K  M  M  F         p.200

          .         .         .     | 07   .         .         .    g.99440
 GAAACTATTCCAATGTTCAGTGGCGGAACTTGCA | ATCCTCAGTTTGTGGTCTGCCAGCTA    c.660
 E  T  I  P  M  F  S  G  G  T  C  N |   P  Q  F  V  V  C  Q  L      p.220

          .         .         .         .         .         .       g.99500
 AAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTAC       c.720
 K  V  K  I  Y  S  S  N  S  G  P  T  R  R  E  D  K  F  M  Y         p.240

          .         .         .         .         .         .       g.99560
 TTTGAGTTCCCTCAGCCGTTACCTGTGTGTGGTGATATCAAAGTAGAGTTCTTCCACAAA       c.780
 F  E  F  P  Q  P  L  P  V  C  G  D  I  K  V  E  F  F  H  K         p.260

          .         .  | 08      .         .         .         .    g.102494
 CAGAACAAGATGCTAAAAAAG | GACAAAATGTTTCACTTTTGGGTAAATACATTCTTCATA    c.840
 Q  N  K  M  L  K  K   | D  K  M  F  H  F  W  V  N  T  F  F  I      p.280

          .         .         .         .         .         .       g.102554
 CCAGGACCAGAGGAAACCTCAGAAAAAGTAGAAAATGGAAGTCTATGTGATCAAGAAATC       c.900
 P  G  P  E  E  T  S  E  K  V  E  N  G  S  L  C  D  Q  E  I         p.300

          .         .         .         .         .         .       g.102614
 GATAGCATTTGCAGTATAGAGCGTGCAGATAATGACAAGGAATATCTAGTACTTACTTTA       c.960
 D  S  I  C  S  I  E  R  A  D  N  D  K  E  Y  L  V  L  T  L         p.320

          .         .         .         .         .         .       g.102674
 ACAAAAAATGATCTTGACAAAGCAAATAAAGACAAAGCCAACCGATACTTTTCTCCAAAT       c.1020
 T  K  N  D  L  D  K  A  N  K  D  K  A  N  R  Y  F  S  P  N         p.340

        | 09 .         .         .         .         .         .    g.106902
 TTTAAG | GTGAAGCTGTACTTCACAAAAACAGTAGAGGAGCCGTCAAATCCAGAGGCTAGC    c.1080
 F  K   | V  K  L  Y  F  T  K  T  V  E  E  P  S  N  P  E  A  S      p.360

          .         .         .         .         .         .       g.106962
 AGTTCAACTTCTGTAACACCAGATGTTAGTGACAATGAACCTGATCATTATAGATATTCT       c.1140
 S  S  T  S  V  T  P  D  V  S  D  N  E  P  D  H  Y  R  Y  S         p.380

          .         .         .         .         .         .       g.107022
 GACACCACTGACTCTGATCCAGAGAATGAACCTTTTGATGAAGATCAGCATACACAAATT       c.1200
 D  T  T  D  S  D  P  E  N  E  P  F  D  E  D  Q  H  T  Q  I         p.400

          .                                                         g.107034
 ACAAAAGTCTGA                                                       c.1212
 T  K  V  X                                                         p.403

          .         .         .         .         .         .       g.107094
 atttttttttatcaagagggataaaacaccatgaaaataaacttgaataaactgaaaatg       c.*60

          .         .         .         .         .         .       g.107154
 gacctttttttttttaatggcaataggacattgtgtcagattaccagttataggaacaat       c.*120

          .         .         .         .         .         .       g.107214
 tctcttttcctgaccaatcttgttttaccctatacatccacagggttttgacacttgttg       c.*180

          .         .         .         .         .         .       g.107274
 tccagttgaaaaaaggttgtgtagctgtgtcatgtatatacctttttgtgtcaaaaggac       c.*240

          .         .         .         .         .         .       g.107334
 atttaaaattcaattaggattaataaagatggcactttcccgttttattccagttttata       c.*300

          .         .         .         .         .         .       g.107394
 aaaagtggagacagactgatgtgtatacgtaggaattttttccttttgtgttctgtcacc       c.*360

          .         .         .         .         .         .       g.107454
 aactgaagtggctaaagagctttgtgatatactggttcacatcctacccctttgcacttg       c.*420

          .         .         .         .         .         .       g.107514
 tggcaacagataagtttgcagttggctaagagaggtttccgaagggttttgctacattct       c.*480

          .         .         .         .         .         .       g.107574
 aatgcatgtattcgggttaggggaatggagggaatgctcagaaaggaaataattttatgc       c.*540

          .         .         .         .         .         .       g.107634
 tggactctggaccatataccatctccagctatttacacacacctttctttagcatgctac       c.*600

          .         .         .         .         .         .       g.107694
 agttattaatctggacattcgaggaattggccgctgtcactgcttgttgtttgcgcattt       c.*660

          .         .         .         .         .         .       g.107754
 ttttttaaagcatattggtgctagaaaaggcagctaaaggaagtgaatctgtattggggt       c.*720

          .         .         .         .         .         .       g.107814
 acaggaatgaaccttctgcaacatcttaagatccacaaatgaagggatataaaaataatg       c.*780

          .         .         .         .         .         .       g.107874
 tcataggtaagaaacacagcaacaatgacttaaccatataaatgtggaggctatcaacaa       c.*840

          .         .         .         .         .         .       g.107934
 agaatgggcttgaaacattataaaaattgacaatgatttattaaatatgttttctcaatt       c.*900

          .         .         .         .         .         .       g.107994
 gtaacgacttctccatctcctgtgtaatcaaggccagtgctaaaattcagatgctgttag       c.*960

          .         .         .         .         .         .       g.108054
 tacctacatcagtcaacaacttacacttattttactagttttcaatcataatacctgctg       c.*1020

          .         .         .         .         .         .       g.108114
 tggatgcttcatgtgctgcctgcaagcttcttttttctcattaaatataaaatattttgt       c.*1080

          .         .         .         .         .         .       g.108174
 aatgctgcacagaaattttcaatttgagattctacagtaagcgttttttttctttgaaga       c.*1140

          .         .         .         .         .         .       g.108234
 tttatgatgcacttattcaatagctgtcagccgttccacccttttgaccttacacattct       c.*1200

          .         .         .         .         .         .       g.108294
 attacaatgaattttgcagttttgcacattttttaaatgtcattaactgttagggaattt       c.*1260

          .         .         .         .         .         .       g.108354
 tacttgaatactgaatacatataatgtttatattaaaaaggacatttgtgttaaaaagga       c.*1320

          .         .         .         .         .         .       g.108414
 aattagagttgcagtaaactttcaatgctgcacacaaaaaaaagacatttgatttttcag       c.*1380

          .         .         .         .         .         .       g.108474
 tagaaattgtcctacatgtgctttattgatttgctattgaaagaatagggtttttttttt       c.*1440

          .         .         .         .         .         .       g.108534
 tttttttttttttttttttaaatgtgcagtgttgaatcatttcttcatagtgctcccccg       c.*1500

          .         .         .         .         .         .       g.108594
 agttgggactagggcttcaatttcacttcttaaaaaaaatcatcatatatttgatatgcc       c.*1560

          .         .         .         .         .         .       g.108654
 cagactgcatacgattttaagcggagtacaactactattgtaaagctaatgtgaagatat       c.*1620

          .         .         .         .         .         .       g.108714
 tattaaaaaggtttttttttccagaaatttggtgtcttcaaattataccttcaccttgac       c.*1680

          .         .         .         .         .         .       g.108774
 atttgaatatccagccattttgtttcttaatggtataaaattccattttcaataacttat       c.*1740

          .         .         .         .         .         .       g.108834
 tggtgctgaaattgttcactagctgtggtctgacctagttaatttacaaatacagattga       c.*1800

          .         .         .         .         .         .       g.108894
 ataggacctactagagcagcatttatagagtttgatggcaaatagattaggcagaacttc       c.*1860

          .         .         .         .         .         .       g.108954
 atctaaaatattcttagtaaataatgttgacacgttttccataccttgtcagtttcattc       c.*1920

          .         .         .         .         .         .       g.109014
 aacaatttttaaatttttaacaaagctcttaggatttacacatttatatttaaacattga       c.*1980

          .         .         .         .         .         .       g.109074
 tatatagagtattgattgattgctcataagttaaattggtaaagttagagacaactattc       c.*2040

          .         .         .         .         .         .       g.109134
 taacacctcaccattgaaatttatatgccaccttgtctttcataaaagctgaaaattgtt       c.*2100

          .         .         .         .         .         .       g.109194
 acctaaaatgaaaatcaacttcatgttttgaagatagttataaatattgttctttgttac       c.*2160

          .         .         .         .         .         .       g.109254
 aatttcgggcaccgcatattaaaacgtaactttattgttccaatatgtaacatggagggc       c.*2220

          .         .         .         .         .         .       g.109314
 caggtcataaataatgacattataatgggcttttgcactgttattatttttcctttggaa       c.*2280

          .         .         .         .         .         .       g.109374
 tgtgaaggtctgaatgagggttttgattttgaatgtttcaatgtttttgagaagccttgc       c.*2340

          .         .         .         .         .         .       g.109434
 ttacattttatggtgtagtcattggaaatggaaaaatggcattatatatattatatatat       c.*2400

          .         .         .         .         .         .       g.109494
 aaatatatattatacatactctccttactttatttcagttaccatccccatagaatttga       c.*2460

          .         .         .         .         .         .       g.109554
 caagaattgctatgactgaaaggttttcgagtcctaattaaaactttatttatggcagta       c.*2520

          .         .         .         .         .         .       g.109614
 ttcataattagcctgaaatgcattctgtaggtaatctctgagtttctggaatattttctt       c.*2580

          .         .         .         .         .         .       g.109674
 agactttttggatgtgcagcagcttacatgtctgaagttacttgaaggcatcacttttaa       c.*2640

          .         .         .         .         .         .       g.109734
 gaaagcttacagttgggccctgtaccatcccaagtcctttgtagctcctcttgaacatgt       c.*2700

          .         .         .         .         .         .       g.109794
 ttgccatacttttaaaagggtagttgaataaatagcatcaccattctttgctgtggcaca       c.*2760

          .         .         .         .         .         .       g.109854
 ggttataaacttaagtggagtttaccggcagcatcaaatgtttcagctttaaaaaataaa       c.*2820

          .         .         .         .         .         .       g.109914
 agtagggtacaagtttaatgtttagttctagaaattttgtgcaatatgttcataacgatg       c.*2880

          .         .         .         .         .         .       g.109974
 gctgtggttgccacaaagtgcctcgtttacctttaaatactgttaatgtgtcatgcatgc       c.*2940

          .         .         .         .         .         .       g.110034
 agatggaaggggtggaactgtgcactaaagtgggggctttaactgtagtatttggcagag       c.*3000

          .         .         .         .         .         .       g.110094
 ttgccttctacctgccagttcaaaagttcaacctgttttcatatagaatatatatactaa       c.*3060

          .         .         .         .         .         .       g.110154
 aaaatttcagtctgttaaacagccttactctgattcagcctcttcagatactcttgtgct       c.*3120

          .         .         .         .         .         .       g.110214
 gtgcagcagtggctctgtgtgtaaatgctatgcactgaggatacacaaaaataccaatat       c.*3180

          .         .         .         .         .         .       g.110274
 gatgtgtacaggataatgcctcatcccaatcagatgtccatttgttattgtgtttgttaa       c.*3240

          .         .         .         .         .         .       g.110334
 caaccctttatctcttagtgttataaactccacttaaaactgattaaagtctcattcttg       c.*3300

                                                                    g.110337
 tca                                                                c.*3303

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Phosphatase and tensin homolog protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center