parathyroid hormone-like hormone (PTHLH) - coding DNA reference sequence

(used for variant description)

(last modified May 9, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_198965.1 in the PTHLH gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_023197.1, covering PTHLH transcript NM_198965.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5022
                                       cctgcatctttttggaaggatt       c.-301

 .         .         .         .     | 02   .         .             g.6741
 ctttttataaatcagaaagtgttcgaggttcaaag | gtttgcctcggagcgtgtgaacatt    c.-241

 .         .         .         .         .         .                g.6801
 cctccgctcggttttcaactcgcctccaacctgcgccgcccggccagcatgtctccccgc       c.-181

 .         .         .         .         .         .                g.6861
 ccgtgaagcggggctgccgcctccctgccgctccggctgccactaacgacccgccctcgc       c.-121

 .         .         .         .         .         .                g.6921
 cgccacctggccctcctgatcgacgacacacgcacttgaaacttgttctcagggtgtgtg       c.-61

 .         .         .         .        | 03.         .             g.7489
 gaatcaactttccggaagcaaccagcccaccagaggag | gtcccgagcgcgagcggagacg    c.-1

          .         .         .         .         .         .       g.7549
 ATGCAGCGGAGACTGGTTCAGCAGTGGAGCGTCGCGGTGTTCCTGCTGAGCTACGCGGTG       c.60
 M  Q  R  R  L  V  Q  Q  W  S  V  A  V  F  L  L  S  Y  A  V         p.20

          .         .         .         .  | 04      .         .    g.13232
 CCCTCCTGCGGGCGCTCGGTGGAGGGTCTCAGCCGCCGCCT | CAAAAGAGCTGTGTCTGAA    c.120
 P  S  C  G  R  S  V  E  G  L  S  R  R  L  |  K  R  A  V  S  E      p.40

          .         .         .         .         .         .       g.13292
 CATCAGCTCCTCCATGACAAGGGGAAGTCCATCCAAGATTTACGGCGACGATTCTTCCTT       c.180
 H  Q  L  L  H  D  K  G  K  S  I  Q  D  L  R  R  R  F  F  L         p.60

          .         .         .         .         .         .       g.13352
 CACCATCTGATCGCAGAAATCCACACAGCTGAAATCAGAGCTACCTCGGAGGTGTCCCCT       c.240
 H  H  L  I  A  E  I  H  T  A  E  I  R  A  T  S  E  V  S  P         p.80

          .         .         .         .         .         .       g.13412
 AACTCCAAGCCCTCTCCCAACACAAAGAACCACCCCGTCCGATTTGGGTCTGATGATGAG       c.300
 N  S  K  P  S  P  N  T  K  N  H  P  V  R  F  G  S  D  D  E         p.100

          .         .         .         .         .         .       g.13472
 GGCAGATACCTAACTCAGGAAACTAACAAGGTGGAGACGTACAAAGAGCAGCCGCTCAAG       c.360
 G  R  Y  L  T  Q  E  T  N  K  V  E  T  Y  K  E  Q  P  L  K         p.120

          .         .         .         .         .         .       g.13532
 ACACCTGGGAAGAAAAAGAAAGGCAAGCCCGGGAAACGCAAGGAGCAGGAAAAGAAAAAA       c.420
 T  P  G  K  K  K  K  G  K  P  G  K  R  K  E  Q  E  K  K  K         p.140

          .         .         .         .         .         .       g.13592
 CGGCGAACTCGCTCTGCCTGGTTAGACTCTGGAGTGACTGGGAGTGGGCTAGAAGGGGAC       c.480
 R  R  T  R  S  A  W  L  D  S  G  V  T  G  S  G  L  E  G  D         p.160

          .         .         .         .     | 05   .              g.18431
 CACCTGTCTGACACCTCCACAACGTCGCTGGAGCTCGATTCACG | GAGGCATTGA          c.534
 H  L  S  D  T  S  T  T  S  L  E  L  D  S  R  |  R  H  X            p.177

          .         .         .         .         .         .       g.18491
 aattttcagcagagaccttccaaggacatattgcaggattctgtaatagtgaacatatgg       c.*60

          .         .         .         .         .         .       g.18551
 aaagtattagaaatatttattgtctgtaaatactgtaaatgcattggaataaaactgtct       c.*120

          .         .         .         .         .         .       g.18611
 cccccattgctctatgaaactgcacattggtcattgtgaatattttttttttgccaaggc       c.*180

          .         .         .         .         .         .       g.18671
 taatccaattattattatcacatttaccataatttattttgtccattgatgtatttattt       c.*240

          .         .         .         .         .         .       g.18731
 tgtaaatgtatcttggtgctgctgaatttctatattttttgtaacataatgcactttaga       c.*300

          .         .         .         .         .         .       g.18791
 tatacatatcaagtatgttgataaatgacacaatgaagtgtctctattttgtggttgatt       c.*360

          .         .         .         .         .         .       g.18851
 ttaatgaatgcctaaatataattatccaaattgattttcctttgtgcatgtaaaaataac       c.*420

          .         .         .         .         .                 g.18906
 agtattttaaatttgtaaagaatgtctaataaaatataatctaattacatcatga            c.*475

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Parathyroid hormone-like hormone protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.