6-pyruvoyltetrahydropterin synthase (PTS) - coding DNA reference sequence

(used for variant description)

(last modified February 3, 2022)

This file was created to facilitate the description of sequence variants on transcript NM_000317.2 in the PTS gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000011.9, covering PTS transcript NM_000317.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5019
                                          gcgcagccgcggtgggagg       c.-61

 .         .         .         .         .         .                g.5079
 aggcaccggccgcgcggcgggaggaggtgccggccgagcaccgcagacagcgccgggaag       c.-1

          .         .         .         .         .         .       g.5139
 ATGAGCACGGAAGGTGGTGGCCGTCGCTGCCAGGCACAAGTGTCCCGCCGCATCTCCTTC       c.60
 M  S  T  E  G  G  G  R  R  C  Q  A  Q  V  S  R  R  I  S  F         p.20

          .         .    | 02    .         .         .         .    g.7266
 AGCGCGAGCCACCGATTGTACAG | TAAATTTCTAAGTGATGAAGAAAACTTGAAACTGTTT    c.120
 S  A  S  H  R  L  Y  S  |  K  F  L  S  D  E  E  N  L  K  L  F      p.40

          .         .         .         .    | 03    .         .    g.8860
 GGGAAATGCAACAATCCAAATGGCCATGGGCACAATTATAAAG | TTGTGGTGACAGTACAT    c.180
 G  K  C  N  N  P  N  G  H  G  H  N  Y  K  V |   V  V  T  V  H      p.60

        | 04 .         .         .         .         .         .    g.9315
 GGAGAG | ATTGACCCTGCTACGGGAATGGTTATGAATCTGGCTGATCTCAAAAAATATATG    c.240
 G  E   | I  D  P  A  T  G  M  V  M  N  L  A  D  L  K  K  Y  M      p.80

     | 05    .         .         .         .         .         .    g.11855
 GAG | GAGGCGATTATGCAGCCCCTTGATCATAAGAATCTGGATATGGATGTGCCATACTTT    c.300
 E   | E  A  I  M  Q  P  L  D  H  K  N  L  D  M  D  V  P  Y  F      p.100

          .     | 06   .         .         .         .         .    g.12113
 GCAGATGTGGTGAG | CACGACTGAAAATGTAGCTGTTTATATCTGGGACAACCTCCAGAAA    c.360
 A  D  V  V  S  |  T  T  E  N  V  A  V  Y  I  W  D  N  L  Q  K      p.120

          .         .         .         .         .         .       g.12173
 GTTCTTCCTGTAGGAGTTCTTTATAAAGTAAAAGTATACGAAACTGACAATAATATTGTG       c.420
 V  L  P  V  G  V  L  Y  K  V  K  V  Y  E  T  D  N  N  I  V         p.140

          .                                                         g.12191
 GTTTATAAAGGAGAATAG                                                 c.438
 V  Y  K  G  E  X                                                   p.145

          .         .         .         .         .         .       g.12251
 ctattggggttagcattgcacaaagcccagtttctttctgtgtttgaaaaagattttgat       c.*60

          .         .         .         .         .         .       g.12311
 ccccttggaatattaagaggtcaacacgtgattgttgtacgtacacattgtgctctggag       c.*120

          .         .         .         .         .         .       g.12371
 tgcctatttattgaaatcattgtaagacctgttataaatttaagtctatttaaaactaaa       c.*180

          .         .         .         .         .         .       g.12431
 cttgtaatatacatcctgaaaatcatttagagagtcttttatttataaattaaaaatcac       c.*240

          .         .         .         .         .         .       g.12491
 ttcattttcacaaaatgttttggtgtgggattatttgaaagcaaaagaaatctaattttg       c.*300

          .         .         .         .         .         .       g.12551
 ttttctccattacctcattttagtattaatttttacttggtataatatacatggttaaaa       c.*360

          .         .         .         .         .                 g.12609
 tgcttatgtgacttcgagtaggtgaatcttaaagaaataaaattcaagtgaccacaaa         c.*418

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The 6-pyruvoyltetrahydropterin synthase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.