RAB1A, member RAS oncogene family (RAB1A) - coding DNA reference sequence

(used for variant description)

(last modified November 10, 2023)

This file was created to facilitate the description of sequence variants on transcript NM_004161.4 in the RAB1A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000002.11, covering RAB1A transcript NM_004161.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5026
                                   caggtacgcatgccccagaggcgcgg       c.-361

 .         .         .         .         .         .                g.5086
 cgcttggcgggaagctgagtcctggccttgcgtcgcactgtctgtcctcagctcgcgtag       c.-301

 .         .         .         .         .         .                g.5146
 ccgcgctcgcgactccctttcccggcatgccaggcggtgcggccgccctctgggccgtgt       c.-241

 .         .         .         .         .         .                g.5206
 aaaggcccctcggtctaaggcttccctatttcctggttcgccggcggccattttgggtgg       c.-181

 .         .         .         .         .         .                g.5266
 aagcgatagctgagtggcggcggctgctgattgtgttctaggggacggagtaggggaaga       c.-121

 .         .         .         .         .         .                g.5326
 cgtttgctctcccggaacagcctatctcattcctttctttcgattacccgtggcgcggag       c.-61

 .         .         .         .         .         .                g.5386
 agtcagggcggcggctgcggcagcaagggcggcggtggcggcggcggcagctgcagtgac       c.-1

          .         .    | 02    .         .         .         .    g.30532
 ATGTCCAGCATGAATCCCGAATA | TGATTATTTATTCAAGTTACTTCTGATTGGCGACTCA    c.60
 M  S  S  M  N  P  E  Y  |  D  Y  L  F  K  L  L  L  I  G  D  S      p.20

          .         .         .       | 03 .         .         .    g.37259
 GGGGTTGGAAAGTCTTGCCTTCTTCTTAGGTTTGCA | GATGATACATATACAGAAAGCTAC    c.120
 G  V  G  K  S  C  L  L  L  R  F  A   | D  D  T  Y  T  E  S  Y      p.40

          .         .         .         .         .         .       g.37319
 ATCAGCACAATTGGTGTGGATTTCAAAATAAGAACTATAGAGTTAGACGGGAAAACAATC       c.180
 I  S  T  I  G  V  D  F  K  I  R  T  I  E  L  D  G  K  T  I         p.60

          .   | 04     .         .         .         .         .    g.44271
 AAGCTTCAAATA | TGGGACACAGCAGGCCAGGAAAGATTTCGAACAATCACCTCCAGTTAT    c.240
 K  L  Q  I   | W  D  T  A  G  Q  E  R  F  R  T  I  T  S  S  Y      p.80

          .         .         .         .         | 05         .    g.46243
 TACAGAGGAGCCCATGGCATCATAGTTGTGTATGATGTGACAGATCAG | GAGTCCTTCAAT    c.300
 Y  R  G  A  H  G  I  I  V  V  Y  D  V  T  D  Q   | E  S  F  N      p.100

          .         .         .         .         .         .       g.46303
 AATGTTAAACAGTGGCTGCAGGAAATAGATCGTTATGCCAGTGAAAATGTCAACAAATTG       c.360
 N  V  K  Q  W  L  Q  E  I  D  R  Y  A  S  E  N  V  N  K  L         p.120

          .         .         .         .         .         .       g.46363
 TTGGTAGGGAACAAATGTGATCTGACCACAAAGAAAGTAGTAGACTACACAACAGCGAAG       c.420
 L  V  G  N  K  C  D  L  T  T  K  K  V  V  D  Y  T  T  A  K         p.140

  | 06       .         .         .         .         .         .    g.46671
  | GAATTTGCTGATTCCCTTGGAATTCCGTTTTTGGAAACCAGTGCTAAGAATGCAACGAAT    c.480
  | E  F  A  D  S  L  G  I  P  F  L  E  T  S  A  K  N  A  T  N      p.160

          .         .         .         .         .         .       g.46731
 GTAGAACAGTCTTTCATGACGATGGCAGCTGAGATTAAAAAGCGAATGGGTCCCGGAGCA       c.540
 V  E  Q  S  F  M  T  M  A  A  E  I  K  K  R  M  G  P  G  A         p.180

          .         .         .         .         .         .       g.46791
 ACAGCTGGTGGTGCTGAGAAGTCCAATGTTAAAATTCAGAGCACTCCAGTCAAGCAGTCA       c.600
 T  A  G  G  A  E  K  S  N  V  K  I  Q  S  T  P  V  K  Q  S         p.200

          .                                                         g.46809
 GGTGGAGGTTGCTGCTAA                                                 c.618
 G  G  G  C  C  X                                                   p.205

          .         .         .         .         .         .       g.46869
 aatttgcctccatccttttctcacagcaatgaatttgcaatctgaacccaagtgaaaaaa       c.*60

          .         .         .         .         .         .       g.46929
 caaaattgcctgaattgtactgtatgtagctgcactacaacagattcttaccgtctccac       c.*120

          .         .         .         .         .         .       g.46989
 aaaggtcagagattgtaaatggtcaatactgactttttttttattcccttgactcaagac       c.*180

          .         .         .         .         .         .       g.47049
 agctaacttcattttcagaactgttttaaacctttgtgtgctggtttataaaataatgtg       c.*240

          .         .         .         .         .         .       g.47109
 tgtaatccttgttgctttcctgataccagactgtttcccgtggttggttagaatatattt       c.*300

          .         .         .         .         .         .       g.47169
 tgttttgatgtttatattggcatgtttagatgtcaggtttagtcttctgaagatgaagtt       c.*360

          .         .         .         .         .         .       g.47229
 cagccattttgtatcaaacagcacaagcagtgtctgtcactttccatgcataaagtttag       c.*420

          .         .         .         .         .         .       g.47289
 tgagatgttatatgtaagatctgatttgctagttcttccttgtagagttataaatggaaa       c.*480

          .         .         .         .         .         .       g.47349
 gattacactatctgattaatagtttcttcatactctgcatataatttgtggctgcagaat       c.*540

          .         .         .         .         .         .       g.47409
 attgtaatttgttgcacactatgtaacaaaacaactgaagatatgtttaataaatattgt       c.*600

          .         .         .         .         .         .       g.47469
 acttattggaagtaatatcaaactgtatggtgataagtattgttttgattcttatggtta       c.*660

          .         .         .         .         .         .       g.47529
 aagggaaatagagccttgcattatattcaacacagccatttgtgtgtgcacaatgcaaac       c.*720

          .         .         .         .         .         .       g.47589
 taaggtattctagacctatcttagagcagcatccagtatttgctttctagataatatgcc       c.*780

          .         .         .         .         .         .       g.47649
 caataacatgacctagaggggcttctgtgctgtgtagggatttaaccaacttcagtggtt       c.*840

          .         .         .         .         .         .       g.47709
 cagggagctcaaactatatgtaaaacaagtttagaatgtatgctatctagcccgttatct       c.*900

          .         .         .         .         .         .       g.47769
 ctgatccttctctaaaaccatttgaaatagcttcattgatcaacatttcataaatgcatc       c.*960

          .         .         .         .         .         .       g.47829
 tgtggtagaggtagaaagcagcacctttcctaattggcaaatgatcagactaatgtgtgc       c.*1020

          .         .         .         .         .         .       g.47889
 taatgtttttcttccatgctttcagtcagattcaactattttatcctccacagttgctta       c.*1080

          .         .         .         .         .         .       g.47949
 acttggtgttggaggagggtttaagcattaagataggaagcaggaaatttgattgctcta       c.*1140

          .         .         .         .         .         .       g.48009
 aatttagaaattatatccctaaaaattaaaacatgaatactgggtggtaatgataattga       c.*1200

          .         .         .         .         .         .       g.48069
 ggcaaatgtatttattttggtgacattttgcatatatgaagattttctgaaataggacct       c.*1260

          .         .         .         .         .         .       g.48129
 tcaagatcctagggggttttgtttggtttttaattgtgaggaataaaaaatcttctgccc       c.*1320

          .         .         .         .         .         .       g.48189
 acactggcattttaaggtgactgaggtcaaacgttgtttccttaggttgaaatagcagcc       c.*1380

          .         .         .         .         .         .       g.48249
 aaaacattcttcacgcaggggcttgggatatggctgctggcaacacattttgttgtgggc       c.*1440

          .         .         .         .         .         .       g.48309
 tccttaatttaatgataaaatttaagctaaacacaagccaaaaatgaataggttttttta       c.*1500

          .         .         .         .         .         .       g.48369
 atttttatttttcactaaacaggcaattgaaatacatggtacaaaaataagtggtaagat       c.*1560

          .         .         .         .         .         .       g.48429
 aattgtaaaatgaaatggacagaatattcaattttccatctatgaaaatttcacaataaa       c.*1620

          .                                                         g.48448
 aatcatagtttactttgta                                                c.*1639

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The RAB1A, member RAS oncogene family protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.