RAB39B, member RAS oncogene family (RAB39B) - coding DNA reference sequence

(used for variant description)

(last modified April 21, 2017)

This file was created to facilitate the description of sequence variants on transcript NM_171998.2 in the RAB39B gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012626.2, covering RAB39B transcript NM_171998.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5039
                      ccaggcgtcgcgtctacgcgggggattacagtaacccgg       c.-241

 .         .         .         .         .         .                g.5099
 ttgtcagtgatgagtcagagtgcgtggtgctgatgctgctgccatttcatcacctttgcg       c.-181

 .         .         .         .         .         .                g.5159
 agcgcagcatccatccctccgctctcccggcgcctgggcctacccagcttcgggctccca       c.-121

 .         .         .         .         .         .                g.5219
 ggccagcgatgcgctcgcggctgagctagatcctgccgagccgcgctctctgaggcgtcg       c.-61

 .         .         .         .         .         .                g.5279
 gcggggcgccccctcccgccgtccccggtccgggccaaggagacctgcagagccgcggcc       c.-1

          .         .         .         .         .         .       g.5339
 ATGGAGGCCATCTGGCTGTACCAGTTCCGGCTCATTGTCATCGGGGATTCCACAGTGGGC       c.60
 M  E  A  I  W  L  Y  Q  F  R  L  I  V  I  G  D  S  T  V  G         p.20

          .         .         .         .         .         .       g.5399
 AAGTCCTGCCTGATCCGCCGCTTCACCGAGGGTCGCTTTGCCCAGGTTTCTGACCCCACC       c.120
 K  S  C  L  I  R  R  F  T  E  G  R  F  A  Q  V  S  D  P  T         p.40

          .         .         .         .         .         .       g.5459
 GTGGGGGTGGATTTTTTCTCCCGCTTGGTGGAGATCGAGCCAGGAAAACGCATCAAGCTC       c.180
 V  G  V  D  F  F  S  R  L  V  E  I  E  P  G  K  R  I  K  L         p.60

          .         .         .      | 02  .         .         .    g.8363
 CAGATCTGGGATACCGCGGGTCAAGAGAGGTTCAG | ATCCATCACTCGCGCCTACTACAGG    c.240
 Q  I  W  D  T  A  G  Q  E  R  F  R  |  S  I  T  R  A  Y  Y  R      p.80

          .         .         .         .         .         .       g.8423
 AACTCAGTAGGTGGTCTTCTCTTATTTGACATTACCAACCGCAGGTCCTTCCAGAATGTC       c.300
 N  S  V  G  G  L  L  L  F  D  I  T  N  R  R  S  F  Q  N  V         p.100

          .         .         .         .         .         .       g.8483
 CATGAGTGGTTAGAAGAGACCAAAGTACACGTTCAGCCCTACCAAATTGTATTTGTTCTG       c.360
 H  E  W  L  E  E  T  K  V  H  V  Q  P  Y  Q  I  V  F  V  L         p.120

          .         .         .         .         .         .       g.8543
 GTGGGTCACAAGTGTGACCTGGATACACAGAGGCAAGTGACTCGCCACGAGGCCGAGAAA       c.420
 V  G  H  K  C  D  L  D  T  Q  R  Q  V  T  R  H  E  A  E  K         p.140

          .         .         .         .         .         .       g.8603
 CTGGCTGCTGCATACGGCATGAAGTACATTGAAACGTCAGCCCGAGATGCCATTAATGTG       c.480
 L  A  A  A  Y  G  M  K  Y  I  E  T  S  A  R  D  A  I  N  V         p.160

          .         .         .         .         .         .       g.8663
 GAGAAAGCCTTCACAGACCTGACAAGAGACATATATGAGCTGGTTAAAAGGGGGGAGATT       c.540
 E  K  A  F  T  D  L  T  R  D  I  Y  E  L  V  K  R  G  E  I         p.180

          .         .         .         .         .         .       g.8723
 ACAATCCAGGAGGGCTGGGAAGGGGTGAAGAGTGGATTTGTACCAAATGTGGTTCACTCT       c.600
 T  I  Q  E  G  W  E  G  V  K  S  G  F  V  P  N  V  V  H  S         p.200

          .         .         .         .                           g.8765
 TCAGAAGAGGTTGTCAAATCAGAGAGGAGATGTTTGTGCTAG                         c.642
 S  E  E  V  V  K  S  E  R  R  C  L  C  X                           p.213

          .         .         .         .         .         .       g.8825
 tcagttcttttatttccaaaacatgctctcctacttgaactgaaaagtaagagaaataaa       c.*60

          .         .         .         .         .         .       g.8885
 tagaatctttgtgtaactgatgagaactcaacctccatttggataccaagtgagcctccc       c.*120

          .         .         .         .         .         .       g.8945
 tctcagggggactctgacagactcgtgtgcgggtggatgggggtgcctgagtgctgtgac       c.*180

          .         .         .         .         .         .       g.9005
 caagggactgaattgctgacatgggccaggccaggcactgttttgtggcccatgctaggc       c.*240

          .         .         .         .         .         .       g.9065
 agtggctgctccatgagccctttgtggaccacatgttaaaggcctggggtttaggaagct       c.*300

          .         .         .         .         .         .       g.9125
 aagtcccaggaaaacatacctacagacaggacaactgttccttggtatttgagctcactt       c.*360

          .         .         .         .         .         .       g.9185
 ataggccatgaacataaagaaatacataaaggggaaaaaagtttcacaatggggacaatt       c.*420

          .         .         .         .         .         .       g.9245
 agcataactaaacaaagattatgagctctacttattccgtgagaataccctgcaccaaag       c.*480

          .         .         .         .         .         .       g.9305
 gtgtttgctgggtttggttaaaaggtaccaattagcttttaacagctttctgtaaaatga       c.*540

          .         .         .         .         .         .       g.9365
 ggaacacagaccaaaaggtctggtgttcaagtaaaaatgatgtgactatggaaaggaagg       c.*600

          .         .         .         .         .         .       g.9425
 caatcgacacagttattagcacatttcagaaaatgaacacccttgtgatagaattaccag       c.*660

          .         .         .         .         .         .       g.9485
 ctgtatgaaacaaattgtcccatgcaaattaccctataactaggaaagagacactataac       c.*720

          .         .         .         .         .         .       g.9545
 ccaaatgccataccccctttttcctttgaccatgcctggggtttcaatgccttggcacct       c.*780

          .         .         .         .         .         .       g.9605
 gcaatctggaagtaaacagtctgcttgcttcttcaggcacgtgacagtgacaacacagtg       c.*840

          .         .         .         .         .         .       g.9665
 actgcctctgaaaagagccctgaggcaaacactctctcctgctgaacaggaggcactgta       c.*900

          .         .         .         .         .         .       g.9725
 acccttacaaacagcttacagttacttgggctacttatttgatcatcataacaggcctac       c.*960

          .         .         .         .         .         .       g.9785
 gaggtttttgccccattttacagaatagtaaactaagagccatgaaaatcacttggccag       c.*1020

          .         .         .         .         .         .       g.9845
 ggtcaaggactcgtgactcctagctcttttcactgcatcatactgctgtcagatgaataa       c.*1080

          .         .         .         .         .         .       g.9905
 atgattatgaatttgtttacttgggaagagatatgactataaataaatgttctctacatg       c.*1140

          .         .         .         .         .         .       g.9965
 ttaggatatgttttccttattgattacaactcagctataatcctgagggaacatgggaag       c.*1200

          .         .         .         .         .         .       g.10025
 gaatcaaaggtaaagcccattcaggcattattgacaagagggctttaaacaagtgaataa       c.*1260

          .         .         .         .         .         .       g.10085
 ttgcacaactaaaaagacattagaactgtgtgggctataagtgttcttatcactgagaca       c.*1320

          .         .         .         .         .         .       g.10145
 cagtggatttttattgaaaggaaccacgtacagcaatgcggagtgggatagggataaaat       c.*1380

          .         .         .         .         .         .       g.10205
 acccaccccaaaatgaccttggccacctgtctgccatatacgtacactgagttcctgtct       c.*1440

          .         .         .         .         .         .       g.10265
 acccaagagagtcagcccttaattctcaggtgaacaaacagctaactgcatcagcaaatt       c.*1500

          .         .         .         .         .         .       g.10325
 ggaatggctggcttgaagtttccattattttcttgaagagaggtgatgctttaaattact       c.*1560

          .         .         .         .         .         .       g.10385
 ttttggattgtagccagttcagctaggcaaaagccatacttttcacaattaaaaaaaaaa       c.*1620

          .         .         .         .         .         .       g.10445
 actattctgactagagtcaggtttctcatatccatcgtgataggaaggcctaagaatggc       c.*1680

          .         .         .         .         .         .       g.10505
 aaatcgctttgagatataatattgaacttcagtatgaatgtgaccgaatctgaaactttg       c.*1740

          .         .         .         .         .         .       g.10565
 ggaatttgctttagccagaataaagaaaccaaatcatgaaaattatggaagactattctg       c.*1800

          .         .         .         .         .         .       g.10625
 ccacctgtgccccaagttggatgagcaaaccactttggatcagttcacagcattaactac       c.*1860

          .         .         .         .         .         .       g.10685
 aagtgaactgatcatcttctctatattcatttcacaagagctggcttaggtggggtaatt       c.*1920

          .         .         .         .         .         .       g.10745
 aaattgccaccttcgtggttgtaaaagacaaacaaaacatggcaaatttcattaacacaa       c.*1980

          .         .         .         .         .         .       g.10805
 aatttcatcaactgctatactgaattatgtttagaagattctgaaagcaagattatccag       c.*2040

          .         .         .         .         .         .       g.10865
 tgggtaaatgagagtcgactggattctgtcagttcaaaaaaggaaagaaacaaaacttcc       c.*2100

          .         .         .         .         .         .       g.10925
 ctacaattttcttcactaaaatttattatatgtacagtattcccactcctggcattttct       c.*2160

          .         .         .         .         .         .       g.10985
 ggcaggtttaaaaatattcagcataaatccagcagaggtggctgagcttaattgcttaaa       c.*2220

          .         .         .         .         .         .       g.11045
 taagttctagaaaatttaaaaatcattttagtagaattcagtaccattgtcactgcaata       c.*2280

          .         .         .         .         .         .       g.11105
 agtgggttttagaaaataagtgtgaaaagaatcaggtgttaatataatactaaggataaa       c.*2340

          .         .         .         .         .         .       g.11165
 gctttagaagctattttactacataggtaaagaaaagataaactaacttgtaacaaagac       c.*2400

          .         .         .         .         .         .       g.11225
 cacaactgcatgttggattagattgtctcatatttcagaataaaatgtactgtatacttt       c.*2460

          .         .         .         .         .         .       g.11285
 tcctcactttgttgtgcactgtaatgaaatgtgaaaaatgctttatttagctgtatgtga       c.*2520

          .         .         .         .                           g.11327
 atgaaaatatgcttgtatttagtaaaatgattgattatgtga                         c.*2562

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The RAB39B, member RAS oncogene family protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.