ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) (RAC3) - coding DNA reference sequence

(used for variant description)

(last modified September 29, 2020)


This file was created to facilitate the description of sequence variants on transcript NM_005052.2 in the RAC3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000017.10, covering RAC3 transcript NM_005052.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5046
               tgtctccggccgatcgctcggcgctcgggtccgcggccgctgcggc       c.-61

 .         .         .         .         .         .                g.5106
 gccgggcatttctccgcagctcggctcgcggccgcgcccgccgccgcccggcccgcgccc       c.-1

          .         .         .      | 02  .         .         .    g.5756
 ATGCAGGCCATCAAGTGCGTGGTGGTCGGCGACGG | CGCCGTGGGGAAGACATGCTTGCTG    c.60
 M  Q  A  I  K  C  V  V  V  G  D  G  |  A  V  G  K  T  C  L  L      p.20

          .         .         .         .        | 03.         .    g.6068
 ATCAGCTACACGACCAACGCCTTCCCCGGAGAGTACATCCCCACCGT | TTTTGACAACTAC    c.120
 I  S  Y  T  T  N  A  F  P  G  E  Y  I  P  T  V  |  F  D  N  Y      p.40

          .         .         .         .         .         .       g.6128
 TCTGCCAACGTGATGGTGGACGGGAAACCAGTCAACTTGGGGCTGTGGGACACAGCGGGT       c.180
 S  A  N  V  M  V  D  G  K  P  V  N  L  G  L  W  D  T  A  G         p.60

          .         .         .         .      | 04  .         .    g.6306
 CAGGAGGACTACGATCGGCTGCGGCCACTCTCCTACCCCCAAACT | GACGTCTTTCTGATC    c.240
 Q  E  D  Y  D  R  L  R  P  L  S  Y  P  Q  T   | D  V  F  L  I      p.80

          .         .         .         .         | 05         .    g.6796
 TGCTTCTCTCTGGTGAGCCCGGCCTCCTTCGAGAATGTTCGTGCCAAG | TGGTACCCGGAG    c.300
 C  F  S  L  V  S  P  A  S  F  E  N  V  R  A  K   | W  Y  P  E      p.100

          .         .         .         .         .         .       g.6856
 GTGCGGCACCACTGCCCCCACACGCCCATCCTCCTGGTGGGCACCAAGCTGGACCTCCGC       c.360
 V  R  H  H  C  P  H  T  P  I  L  L  V  G  T  K  L  D  L  R         p.120

          .         .         .         .         .         .       g.6916
 GACGACAAGGACACCATTGAGCGGCTGCGGGACAAGAAGCTGGCACCCATCACCTACCCA       c.420
 D  D  K  D  T  I  E  R  L  R  D  K  K  L  A  P  I  T  Y  P         p.140

          .         .         | 06         .         .         .    g.7075
 CAGGGCCTGGCCATGGCCCGGGAGATTG | GCTCTGTGAAATACCTGGAGTGCTCAGCCCTG    c.480
 Q  G  L  A  M  A  R  E  I  G |   S  V  K  Y  L  E  C  S  A  L      p.160

          .         .         .         .         .         .       g.7135
 ACCCAGCGGGGCCTGAAGACAGTGTTTGACGAGGCGATCCGCGCGGTGCTCTGCCCGCCC       c.540
 T  Q  R  G  L  K  T  V  F  D  E  A  I  R  A  V  L  C  P  P         p.180

          .         .         .                                     g.7174
 CCAGTGAAGAAGCCGGGGAAGAAGTGCACCGTCTTCTAG                            c.579
 P  V  K  K  P  G  K  K  C  T  V  F  X                              p.192

          .         .         .         .         .         .       g.7234
 agccctggcccacccgagcctgagggctggcggggagcagccctggacgtgtccgctgtt       c.*60

          .         .         .         .         .         .       g.7294
 gtgttgagacgtgtggtgtccctgagtcggctgtggggagcggtgggggtgggccggggg       c.*120

          .         .         .         .         .         .       g.7354
 gaagcatggggatgaggctgggtggcaggatcctgtcctctctgccgcctcattctgggg       c.*180

          .         .         .         .         .         .       g.7414
 tgtggctccagccttccctggcccccgccggaggccgggagggagcagggtctccctcag       c.*240

          .         .         .         .         .         .       g.7474
 ggctgcaggggcaggtgcagggaagccccaggatgggcttccctggagggggagggtggg       c.*300

          .         .         .         .         .         .       g.7534
 ggggagttctgttccttgtgccccgaggtggggcagccccttctcattttatacaataaa       c.*360

          .                                                         g.7549
 cattctccacctaca                                                    c.*375

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 24b
©2004-2020 Leiden University Medical Center