RAN guanine nucleotide release factor (RANGRF) - coding DNA reference sequence

(used for variant description)

(last modified May 19, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_016492.4 in the RANGRF gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_028189.1, covering RANGRF transcript NM_016492.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5018
                                           gccaaatcttaaaggatc       c.-121

 .         .         .         .         .         .                g.5078
 cgggagctaagccagacccgggtggcggtggcagctgcgaaacccagggagccgatgcca       c.-61

 .         .         .         .         .         .                g.5138
 cgtgacccaatgtggacttcttttaaacctttctaatgcccataacccagcctcagaccc       c.-1

          .         .         .         .         .         .       g.5198
 ATGGAGCCCACGAGAGACTGCCCGCTGTTCGGGGGCGCCTTTTCCGCCATCCTCCCCATG       c.60
 M  E  P  T  R  D  C  P  L  F  G  G  A  F  S  A  I  L  P  M         p.20

          .        | 02.         .         .         .         .    g.5348
 GGGGCCATTGACGTAAG | CGACCTCCGACCGGTCCCGGACAATCAAGAAGTTTTCTGCCAT    c.120
 G  A  I  D  V  S  |  D  L  R  P  V  P  D  N  Q  E  V  F  C  H      p.40

          .         .         .         .         .         .       g.5408
 CCCGTGACGGACCAGAGCCTGATAGTGGAACTTCTCGAGCTGCAGGCCCACGTACGGGGC       c.180
 P  V  T  D  Q  S  L  I  V  E  L  L  E  L  Q  A  H  V  R  G         p.60

          .     | 03   .         .         .         .         .    g.5653
 GAAGCGGCTGCGCG | GTACCACTTTGAGGATGTTGGTGGCGTGCAGGGGGCTAGGGCTGTC    c.240
 E  A  A  A  R  |  Y  H  F  E  D  V  G  G  V  Q  G  A  R  A  V      p.80

          .         .         .         .         .         .       g.5713
 CATGTGGAGTCTGTTCAGCCTCTCAGTTTGGAGAACCTGGCCCTGAGGGGCCGCTGTCAA       c.300
 H  V  E  S  V  Q  P  L  S  L  E  N  L  A  L  R  G  R  C  Q         p.100

          .         .         .         .         .  | 04      .    g.5861
 GAAGCCTGGGTCCTCTCTGGCAAGCAGCAGATAGCTAAGGAAAACCAGCAG | GTAGCAAAG    c.360
 E  A  W  V  L  S  G  K  Q  Q  I  A  K  E  N  Q  Q   | V  A  K      p.120

          .         .         .         .         .         .       g.5921
 GACGTGACACTTCATCAGGCCTTGCTGAGGCTGCCCCAGTACCAGACTGATCTCTTGCTT       c.420
 D  V  T  L  H  Q  A  L  L  R  L  P  Q  Y  Q  T  D  L  L  L         p.140

          .        | 05.         .         .         .         .    g.6205
 ACCTTCAATCAGCCCCC | CCCTGACAACAGGTCATCTCTTGGCCCCGAAAATCTGTCACCT    c.480
 T  F  N  Q  P  P  |  P  D  N  R  S  S  L  G  P  E  N  L  S  P      p.160

          .         .         .         .         .         .       g.6265
 GCACCCTGGAGCCTGGGTGACTTTGAACAGCTGGTGACCAGTCTGACCCTTCACGATCCT       c.540
 A  P  W  S  L  G  D  F  E  Q  L  V  T  S  L  T  L  H  D  P         p.180

          .         .                                               g.6286
 AACATCTTTGGTCCCCAGTAA                                              c.561
 N  I  F  G  P  Q  X                                                p.186

          .         .         .         .         .         .       g.6346
 aggcgctgaagcactgcatgatgttgctgagaacttggggactcggttctgtgaggggga       c.*60

          .         .         .         .         .         .       g.6406
 aaagaggttgaaaagagggtttcctcttatttcttccctgtgcgtaaacataagacaatc       c.*120

          .         .         .                                     g.6441
 cctcttcagaataaacttgctttataatcaatata                                c.*155

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The RAN guanine nucleotide release factor protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.