retina and anterior neural fold homeobox 2 (RAX2) - coding DNA reference sequence

(used for variant description)

(last modified November 26, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_032753.3 in the RAX2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011565.1, covering RAX2 transcript NM_032753.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.5008
                                                     gcgccagg       c.-61

 .         .         .         .         .         . | 02           g.5479
 cccgctggggcaggtgtcccgtggaaatcgacggaggggctgccgtgggcg | gtgggagcc    c.-1

          .         .         .         .         .         .       g.5539
 ATGTTCCTGAGCCCGGGCGAGGGGCCGGCAACCGAGGGTGGGGGTCTGGGGCCGGGCGAG       c.60
 M  F  L  S  P  G  E  G  P  A  T  E  G  G  G  L  G  P  G  E         p.20

          .         .         .         .         .         .       g.5599
 GAGGCCCCCAAGAAGAAGCACCGGAGGAACCGCACCACCTTCACCACCTACCAGCTGCAC       c.120
 E  A  P  K  K  K  H  R  R  N  R  T  T  F  T  T  Y  Q  L  H         p.40

          .         .         .         .         .         .       g.5659
 CAGCTGGAGCGGGCGTTCGAGGCCTCTCACTACCCGGATGTGTACAGCCGTGAGGAGCTG       c.180
 Q  L  E  R  A  F  E  A  S  H  Y  P  D  V  Y  S  R  E  E  L         p.60

          .         .         .       | 03 .         .         .    g.6286
 GCAGCCAAGGTGCACCTACCTGAGGTGCGCGTGCAG | GTGTGGTTCCAGAACCGCCGGGCC    c.240
 A  A  K  V  H  L  P  E  V  R  V  Q   | V  W  F  Q  N  R  R  A      p.80

          .         .         .         .         .         .       g.6346
 AAGTGGCGCCGCCAGGAGCGGCTGGAGTCAGGCTCGGGTGCCGTGGCAGCTCCGAGACTC       c.300
 K  W  R  R  Q  E  R  L  E  S  G  S  G  A  V  A  A  P  R  L         p.100

          .         .         .         .         .         .       g.6406
 CCCGAGGCCCCAGCGCTGCCGTTCGCCCGCCCCCCGGCCATGTCGCTGCCCCTGGAGCCC       c.360
 P  E  A  P  A  L  P  F  A  R  P  P  A  M  S  L  P  L  E  P         p.120

          .         .         .         .         .         .       g.6466
 TGGTTGGGCCCCGGACCGCCGGCCGTGCCAGGCCTCCCCCGCCTCCTGGGCCCGGGCCCG       c.420
 W  L  G  P  G  P  P  A  V  P  G  L  P  R  L  L  G  P  G  P         p.140

          .         .         .         .         .         .       g.6526
 GGGCTGCAAGCGTCCTTCGGGCCTCATGCCTTTGCTCCCACCTTCGCAGATGGCTTCGCC       c.480
 G  L  Q  A  S  F  G  P  H  A  F  A  P  T  F  A  D  G  F  A         p.160

          .         .         .         .         .         .       g.6586
 CTGGAGGAGGCGTCCCTGCGGCTGCTGGCCAAGGAACATGCACAGGCTCTGGACAGGGCC       c.540
 L  E  E  A  S  L  R  L  L  A  K  E  H  A  Q  A  L  D  R  A         p.180

          .                                                         g.6601
 TGGCCGCCAGCCTGA                                                    c.555
 W  P  P  A  X                                                      p.184

          .         .         .         .         .         .       g.6661
 gcctgccgccctcccgggccccctcctcggcccaacccgagaaccggggacgtgccctgg       c.*60

          .         .         .         .         .         .       g.6721
 tgacagccaccacgccttggcctaggccgaggtcatggagcaaccgtggtcaggccaggc       c.*120

          .         .         .         .         .         .       g.6781
 caccaccactggggagcgggaccagagagacaggctgctgggttccctgcccccatcccg       c.*180

          .         .         .         .         .         .       g.6841
 tctcccaccccatcgccacccgtcctgctggcagcggactggcccccagtgtcaggcagg       c.*240

          .         .         .         .         .         .       g.6901
 aggtgacccaagtattctcaggccaggtgcggggacctcctcccctcctggggcctcagt       c.*300

          .         .         .         .         .         .       g.6961
 ctcctgtctgttaattgggcgtgggggcctccgaggttcgagggctgcgaggctgtgggt       c.*360

          .         .         .         .         .         .       g.7021
 ggcgggaccgctgactctgtaagatgagtgtaaatctctctgcttctcctaatccccatc       c.*420

          .         .         .         .         .         .       g.7081
 agcagagctgcccactctccaggctcccagtcccctggaaataacaaatagcagcagctc       c.*480

          .         .         .         .         .         .       g.7141
 ccgcgagcctggtctcctctcaccgtgtgctcgccatgtgagcactcccctctccgttgt       c.*540

          .         .         .         .         .         .       g.7201
 gccctggacctcgggcacagctgtcagcccattctatagagagggaaaccggggcttagg       c.*600

          .         .         .         .         .         .       g.7261
 caggaagccaggtccccaaagtcgcacggccaggagtggatggagctgcctttcagaccc       c.*660

          .         .         .         .         .         .       g.7321
 atcaccggtcctaccgtccggggcacagcgacaggttctggagagagggtgggtcccggg       c.*720

          .         .         .         .         .         .       g.7381
 ccaggtgctggtgggcctccaggtggaggcgggctgatgctgggtgtgtcgtcatcgtca       c.*780

          .         .         .         .         .         .       g.7441
 gaccgttcctcacgtccccacagaccccaggccctgtgcatgtccccagtggaggcatgg       c.*840

          .         .         .         .         .         .       g.7501
 ccagcatctgctctgtccaacccagccgcatcgcccaagagctctgagcaaggaggctgt       c.*900

          .         .         .         .         .         .       g.7561
 cgcggggccgagaacccgctgggactggcaagcacggctggcccagtgcagcaggagggg       c.*960

          .         .         .         .         .         .       g.7621
 gccctgaggcatgggatgggacagtctgggccagcgccacctcccgggacagaagtgcgg       c.*1020

          .         .         .         .         .         .       g.7681
 caccagggcaggagctgcagtagctaccctccccgtctccagcctgggctccccagatca       c.*1080

          .         .         .         .         .         .       g.7741
 ctcccagatcaccaggtcaccccatctctaggcggcacctcacacaccagtcctgtggtc       c.*1140

          .         .         .         .         .         .       g.7801
 caacgccccgccatcacccaatgtcaccgcacaccaggcagtggggacacggcagtaagc       c.*1200

          .         .         .         .         .         .       g.7861
 acaagaaagatttttttttttaaagctaaaccaggccaggtgcggtggctcatgcctgta       c.*1260

          .         .         .         .         .         .       g.7921
 atcccagtgctttgggaggctgaggtgggaggattgcttgagaccagcctgggtgacaca       c.*1320

          .         .         .         .         .         .       g.7981
 gcaagaccccatctccacaaacgtttttaaaatgtgccgggtgtactggtgcacacctgt       c.*1380

          .         .         .         .         .         .       g.8041
 catcccagctacccaagaagctgaggcaagaggatcacttgagcccagaaggtcgaggct       c.*1440

          .         .         .         .         .         .       g.8101
 gcagggagctgtgatcacactgctgcactccagcctgtgcaacagagccagaccctgact       c.*1500

          .         .         .                                     g.8133
 caatacaaataaaaaacaaatctaaaacaaaa                                   c.*1532

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Retina and anterior neural fold homeobox 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.