retina and anterior neural fold homeobox (RAX) - 303 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5536
gtgagtgcgcacccctggctgtgcgaggccgttcgggcgcccgagcttaggagttggcca  c.289+60

         .         .         .         .         .         .  g.5596
gacgagagcgccccttccttaacttttattaaggcaactgggcgcggggttggggaccgt  c.289+120

         .         .         .    g.5628
ctatggcgggagcttccaatttgcattcagag  c.289+152

--------------------- middle of intron ---------------------
                  g.5629      .         .         .           g.5659
                  c.290-151  aaagcttaggacccatcgccgccctcaccac  c.290-121

.         .         .         .         .         .           g.5719
ggacctccccgggccatctcggagcccgcaggcgggctggccagtgcccacagcgaggcg  c.290-61

.         .         .         .         .         .           g.5779
gggtcggcccaagggtgttttggggagtgcatctgaccctcccgggcctcgtcgccccag  c.290-1


Powered by LOVD v.3.0 Build 30b
©2004-2025 Leiden University Medical Center