receptor accessory protein 6 (REEP6) - coding DNA reference sequence

(used for variant description)

(last modified December 5, 2018)

This file was created to facilitate the description of sequence variants on transcript NM_138393.1 in the REEP6 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_055254.1, covering REEP6 transcript NM_138393.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5044
                 ggagcatcgcggctcaggctgcgggaaagcggtgcgcgtgcagc       c.-61

 .         .         .         .         .         .                g.5104
 ggggtgggtgccctggtccgcgggcgagctcgagcagccaaccccgggcgcgtcggggcc       c.-1

          .         .         .         .         .         .       g.5164
 ATGGACGGCCTGAGGCAGCGCGTGGAGCACTTCCTGGAGCAAAGGAACCTGGTCACCGAA       c.60
 M  D  G  L  R  Q  R  V  E  H  F  L  E  Q  R  N  L  V  T  E         p.20

          .         .         .         .         .      | 02  .    g.9133
 GTGCTGGGGGCGCTGGAGGCCAAGACCGGGGTGGAGAAGCGGTATCTGGCTGCAG | GAGCC    c.120
 V  L  G  A  L  E  A  K  T  G  V  E  K  R  Y  L  A  A  G |   A      p.40

          .         .         .         .         .         .       g.9193
 GTCACTCTGCTAAGCCTGTATCTGCTGTTCGGCTACGGAGCGTCTCTGCTGTGCAATCTC       c.180
 V  T  L  L  S  L  Y  L  L  F  G  Y  G  A  S  L  L  C  N  L         p.60

          .         .          | 03        .         .         .    g.9334
 ATCGGATTTGTGTACCCCGCATATGCCTC | AATCAAAGCTATCGAGAGCCCAAGCAAGGAC    c.240
 I  G  F  V  Y  P  A  Y  A  S  |  I  K  A  I  E  S  P  S  K  D      p.80

          .         .         .         .         .         .       g.9394
 GACGACACTGTGTGGCTCACCTACTGGGTGGTGTACGCCCTGTTTGGGCTGGCCGAGTTC       c.300
 D  D  T  V  W  L  T  Y  W  V  V  Y  A  L  F  G  L  A  E  F         p.100

          .         .         .         .         | 04         .    g.10131
 TTCAGCGATCTACTCCTGTCCTGGTTCCCTTTCTACTACGTGGGCAAG | TGCGCCTTCCTG    c.360
 F  S  D  L  L  L  S  W  F  P  F  Y  Y  V  G  K   | C  A  F  L      p.120

          .         .         .         .         .         .       g.10191
 TTGTTCTGCATGGCTCCCAGGCCCTGGAACGGGGCTCTCATGCTGTATCAGCGCGTCGTG       c.420
 L  F  C  M  A  P  R  P  W  N  G  A  L  M  L  Y  Q  R  V  V         p.140

          .         .         .         .         .         .       g.10251
 CGTCCGCTGTTCCTAAGGCACCACGGGGCCGTAGACAGAATCATGAACGACCTCAGCGGG       c.480
 R  P  L  F  L  R  H  H  G  A  V  D  R  I  M  N  D  L  S  G         p.160

          .         .         .        | 05.         .         .    g.11031
 CGAGCCCTGGACGCGGCGGCCGGAATAACCAGGAACG | TCAAGCCAAGCCAGACCCCGCAG    c.540
 R  A  L  D  A  A  A  G  I  T  R  N  V |   K  P  S  Q  T  P  Q      p.180

          .                                                         g.11046
 CCGAAGGACAAGTGA                                                    c.555
 P  K  D  K  X                                                      p.184

          .         .         .         .         .         .       g.11106
 agcagccccctgagcctcacaaggacctcctggctggtgaggagggggccgcgccaggct       c.*60

          .         .         .         .         .         .       g.11166
 cccaggcctccacagagtcttcagcgcatcccccaacagcagcccctgccagtccctcgg       c.*120

          .         .         .         .         .         .       g.11226
 gtccaggcaaggccctgggggtctccttaaatgccacctcgggcaagtcccagtcccagt       c.*180

          .         .         .         .         .         .       g.11286
 cctcggccacccccagctctggatcccagggccagctgccctctggctctggctgtggct       c.*240

          .         .         .         .         .         .       g.11346
 cccgcctgtccggcagggcccagggccagcgtcgggcacagggcagctcccactggtctc       c.*300

          .         .         .         .         .         .       g.11406
 ggcaacacacccagccgcctggtacttcctccagcccctcccagtcagccctcccgtcct       c.*360

          .         .         .         .         .         .       g.11466
 cggggcccctgcagccacccaacgtcacctccagcccggtctcacccatggtccagtctc       c.*420

          .         .         .         .         .         .       g.11526
 ccagcagcagcaacatccccacgcagccccccagcaagtcctctggcaagccggaggacg       c.*480

          .         .         .         .         .         .       g.11586
 cagcccccaagaccagcggacagcgccagaaggaatcgtcgaaacagcctgccagcagcg       c.*540

          .         .         .         .         .         .       g.11646
 cctcagtgcccgagctggtcccctgccattccgggacctctctggagtacacttcggagt       c.*600

          .         .         .         .         .         .       g.11706
 ccaccaccgagatcacctgcagctggccacaccacaggcccccgtgcctgcagcactact       c.*660

          .         .         .         .         .                 g.11760
 ggtgcctgaaacacctggcctgctaggaggctccaataaagctaacccggacca             c.*714

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Receptor accessory protein 6 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.