regulator of G-protein signaling 12 (RGS12) - 334 nt intron 11 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.113484
gtactgggcccgcctgaccctcgtgctgccctcaggccatgacctccccgctccctggcc  c.3033+60

         .         .         .         .         .         .  g.113544
cccagctttgtcagagtcctcaggctgccccctcctgcgctcctcatttcaacagcgcct  c.3033+120

         .         .         .         .         g.113591
ggggcggaggccggattatctgaactgagctatctgctgggagcact  c.3033+167

--------------------- middle of intron ---------------------
 g.113592           .         .         .         .           g.113638
 c.3034-167  ttgcacgtgggtgctgggttggtgtggaaagggtgatcgctttcttt  c.3034-121

.         .         .         .         .         .           g.113698
ggatggctgtttttgaagctgctcttctgctctgcacagctgtgtgcctggggcacgtgg  c.3034-61

.         .         .         .         .         .           g.113758
gtctgcgtttggggggctgcctgctgtgcccacgttgattctggtctctctgttcctcag  c.3034-1


Powered by LOVD v.3.0 Build 17
©2004-2016 Leiden University Medical Center