ribonuclease H2, subunit C (RNASEH2C) - coding DNA reference sequence

(used for variant description)

(last modified February 4, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_032193.3 in the RNASEH2C gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008976.2, covering RNASEH2C transcript NM_032193.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
 .         .         .         .         .         .                g.5060
 ctggaaaaccctaggacttgaacccagggaaagcgttagggggtaaggggactacacttc       c.-121

 .         .         .         .         .         .                g.5120
 ccgtgaagctccgcggcggcttcccgtgaggccccgcggaggcttcctgagaggtcctgc       c.-61

 .         .         .         .         .         .                g.5180
 gcgctttccgcgccagcttcagtgtcagctcgcgagccctggcgtcgcgtaggagggagg       c.-1

          .         .         .         .         .         .       g.5240
 ATGGAGAGCGGCGACGAAGCGGCCATCGAGAGGCACCGCGTCCACTTGCGCTCCGCCACA       c.60
 M  E  S  G  D  E  A  A  I  E  R  H  R  V  H  L  R  S  A  T         p.20

          .         .         .         .         .         .       g.5300
 TTGCGCGACGCCGTACCCGCCACACTGCATCTGCTGCCCTGCGAGGTTGCGGTGGACGGG       c.120
 L  R  D  A  V  P  A  T  L  H  L  L  P  C  E  V  A  V  D  G         p.40

          .         .         .         .         .   | 02     .    g.5529
 CCCGCCCCGGTGGGGCGCTTCTTCACGCCCGCCATCCGCCAGGGCCCCGAGG | GACTCGAA    c.180
 P  A  P  V  G  R  F  F  T  P  A  I  R  Q  G  P  E  G |   L  E      p.60

          .         .         .         .         .         .       g.5589
 GTGTCGTTTCGGGGCCGCTGTCTACGGGGAGAGGAGGTGGCGGTGCCGCCTGGCCTCGTG       c.240
 V  S  F  R  G  R  C  L  R  G  E  E  V  A  V  P  P  G  L  V         p.80

          .         .         .         .         .         .       g.5649
 GGATACGTGATGGTGACAGAAGAGAAGAAGGTGTCGATGGGGAAGCCAGACCCCTTGCGG       c.300
 G  Y  V  M  V  T  E  E  K  K  V  S  M  G  K  P  D  P  L  R         p.100

          .         .         .         .         | 03         .    g.5786
 GATTCCGGGACTGACGACCAAGAGGAGGAGCCGCTGGAGCGGGACTTC | GACCGCTTCATT    c.360
 D  S  G  T  D  D  Q  E  E  E  P  L  E  R  D  F   | D  R  F  I      p.120

          .         .         .         .         .         .       g.5846
 GGAGCCACTGCCAACTTCAGCCGCTTCACCCTGTGGGGTCTGGAGACCATCCCTGGCCCG       c.420
 G  A  T  A  N  F  S  R  F  T  L  W  G  L  E  T  I  P  G  P         p.140

          .         .         .         .         | 04         .    g.6141
 GATGCCAAAGTGCGTGGGGCCTTAACTTGGCCCAGCCTTGCGGCAGCG | ATTCACGCACAG    c.480
 D  A  K  V  R  G  A  L  T  W  P  S  L  A  A  A   | I  H  A  Q      p.160

          .                                                         g.6156
 GTGCCCGAGGACTGA                                                    c.495
 V  P  E  D  X                                                      p.164

          .         .         .         .         .         .       g.6216
 gaaccagagcttgaaattcaaagctgcgatcccttcacagcagtaaaccagctctttgga       c.*60

          .         .         .         .         .         .       g.6276
 accgattccatcaccccaataaaggagctcttcacagcacctgtgagtctgggcgcctta       c.*120

          .         .         .         .         .         .       g.6336
 gagcccctaagccagcatgggccctttccccctccccaccaagaactttgcatggctctg       c.*180

          .         .         .         .         .         .       g.6396
 gcatatagaaacaatttattgccgggggcaataggggtaagagaagccagaaatttttgc       c.*240

          .         .         .         .         .         .       g.6456
 agccagcacccaccccacccccaacttctactttacaaaagaaatttttacaatcaccag       c.*300

          .         .         .         .         .         .       g.6516
 ccctctgtacagagctcccccatccggatcccttctcactgtacacagctgcctggctcc       c.*360

          .         .         .         .         .         .       g.6576
 ctctggtccctgcttcagaggaggcctgggcctgtggccagctgaccttggagttggtct       c.*420

          .         .         .         .         .         .       g.6636
 gagcccggagctcgccttggtgctgggcaccagtgggcccctgccaggcctgtcctctcc       c.*480

          .         .         .         .         .         .       g.6696
 tttttgagctgtcctcagccccatctcccttagagtgctttgtgggagctgcagtggggg       c.*540

          .         .         .         .         .         .       g.6756
 cggggtgggctatcagccccagtcctgctgccgtcttggcactgcagtgggcagtgtctg       c.*600

          .         .         .         .         .         .       g.6816
 gtcaccacttccccctcttgctccagtccttgggagtgaagtgcagacacttggagtcga       c.*660

          .         .         .         .         .         .       g.6876
 tccgcaggagccgcttgagcatggcccgctcatggccatccacgatgtcctctgacagtg       c.*720

          .         .         .         .         .         .       g.6936
 tgaggatgtactggccctgggcagaggagatgggttcagcaggtggtcagcccacagagg       c.*780

          .         .         .         .         .         .       g.6996
 actgcactctgcatcccacacacctgtctcccctgcctgcctccctaccttgtagtagtt       c.*840

          .         .         .         .         .         .       g.7056
 gatgagattgaggtactgcagagtggagatgacatcctccttcttgatgctggtgatttc       c.*900

          .         .         .         .         .         .       g.7116
 actaatctcactgtgggagagcacaggtcaggttccctgaggacctttatctgtccccag       c.*960

          .         .         .         .         .         .       g.7176
 gagccctgagagagaaagcccaggaacagacaagccatgccatgtacccccaggtagaca       c.*1020

          .         .         .         .         .         .       g.7236
 gcgccaggctcacttgatggtgatctgtggcctctccccgctctccgacttcagccccat       c.*1080

          .         .         .         .         .         .       g.7296
 caggatctccaggatggtctgggaccagtagcttcgataggataggaggccaaggtctga       c.*1140

          .         .         .         .         .         .       g.7356
 gaggggcttctcaggggtccctgttttcccttccactttggagagttcatagcctaaagc       c.*1200

          .         .         .         .         .         .       g.7416
 aatggagcaggagagggtgagtaagaggtcacagatgaacataagcaacatttaaaaaca       c.*1260

          .         .         .         .         .         .       g.7476
 caggttgccaaggcaggctgcctagttcctatcatggccctgccacttggcagttctatg       c.*1320

          .         .         .         .         .         .       g.7536
 ccctccacttctctgtgcctcagttccctcaggaagaactgagtattcactctttccgtg       c.*1380

          .         .         .         .         .         .       g.7596
 cgctgagcacagtggagggcatgagggcactgagaggagcagctgcagtcaaccatgagg       c.*1440

          .         .         .         .         .         .       g.7656
 gtgatcagaggccagtgaaggcttatgggcaggggatgcagagaaaatggctcatgggaa       c.*1500

          .         .         .         .         .         .       g.7716
 gaaggggcctccaattttcctttgccatcccgggctctgtgtctagccatgtaaggaagt       c.*1560

          .         .         .         .         .         .       g.7776
 ggagacagattcctgtctctaatccagacctgagaatgcttgaattctcaaagtcctcct       c.*1620

          .         .         .         .         .         .       g.7836
 agctgggaccttgggagtgtcacctgctgtaagacttgagtggcctgactgggtggttgt       c.*1680

          .         .         .         .         .         .       g.7896
 gaggatgcaaggagaaaaggtgcaccaaggtgcttcctaagtcggggagaccattcctgg       c.*1740

          .         .         .         .         .         .       g.7956
 gagccacgtgactgacccccaccatggctctttccctccaactcgtgctgatagctggcc       c.*1800

          .         .         .         .         .         .       g.8016
 gctgggaggccgtccccagtgagatcctcagaccctgcacagccctgagtggcttcacat       c.*1860

          .         .         .         .         .         .       g.8076
 ctcttggtcagtgtcttcattctccccagtcagggacctgggatgtttgttacttctaga       c.*1920

          .         .         .         .         .         .       g.8136
 agcccttcctcaccctcataatggaccttagccccttgctggtcccactcacatcccgtc       c.*1980

          .         .         .         .         .         .       g.8196
 tccattgctgtctgagttccaagactgagtttcttcaagcatccacttgtgctaccaggc       c.*2040

          .         .         .         .         .         .       g.8256
 tgagaagttctgaggatgtgaccccatctgggcatcatttaaccaataaaatttctcgaa       c.*2100

          .                                                         g.8266
 tggaccataa                                                         c.*2110

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ribonuclease H2, subunit C protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.