ring finger protein 135 (RNF135) - coding DNA reference sequence

(used for variant description)

(last modified August 4, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_032322.3 in the RNF135 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011701.1, covering RNF135 transcript NM_032322.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5016
                                             gggtggcgccaaggaa       c.-121

 .         .         .         .         .         .                g.5076
 ggaggagaaaaggcggccgagaaaaggaggagggcaaggggaagaggaagggcgagggag       c.-61

 .         .         .         .         .         .                g.5136
 gagcctgaggagactcgcccggctcaaccccgacgtccgcgccccggccgcctgttggcc       c.-1

          .         .         .         .         .         .       g.5196
 ATGGCGGGCCTGGGCCTGGGCTCCGCCGTTCCCGTGTGGCTGGCCGAGGACGACCTCGGC       c.60
 M  A  G  L  G  L  G  S  A  V  P  V  W  L  A  E  D  D  L  G         p.20

          .         .         .         .         .         .       g.5256
 TGCATCATCTGCCAGGGGCTGCTGGACTGGCCCGCCACGCTGCCCTGCGGCCACAGCTTC       c.120
 C  I  I  C  Q  G  L  L  D  W  P  A  T  L  P  C  G  H  S  F         p.40

          .         .         .         .         .         .       g.5316
 TGCCGCCACTGCCTGGAGGCCCTGTGGGGCGCCCGCGACGCCCGCCGCTGGGCCTGCCCC       c.180
 C  R  H  C  L  E  A  L  W  G  A  R  D  A  R  R  W  A  C  P         p.60

          .         .         .         .         .         .       g.5376
 ACTTGCCGCCAGGGCGCCGCGCAGCAGCCGCACCTGCGGAAGAACACGCTACTGCAGGAC       c.240
 T  C  R  Q  G  A  A  Q  Q  P  H  L  R  K  N  T  L  L  Q  D         p.80

          .         .         .         .         .         .       g.5436
 CTGGCCGACAAGTACCGCCGCGCCGCACGCGAGATACAGGCGGGCTCCGACCCTGCCCAC       c.300
 L  A  D  K  Y  R  R  A  A  R  E  I  Q  A  G  S  D  P  A  H         p.100

          .         .         .         .         .         .       g.5496
 TGCCCCTGCCCGGGCTCCAGTTCCCTCTCCAGCGCGGCCGCGAGGCCCCGGCGCCGCCCG       c.360
 C  P  C  P  G  S  S  S  L  S  S  A  A  A  R  P  R  R  R  P         p.120

          .   | 02     .         .         .         .         .    g.18727
 GAACTGCAGCGG | GTGGCAGTAGAGAAGAGCATCACAGAAGTTGCTCAGGAGCTGACAGAG    c.420
 E  L  Q  R   | V  A  V  E  K  S  I  T  E  V  A  Q  E  L  T  E      p.140

          .         .         .         .         .         .       g.18787
 CTGGTGGAACATCTTGTAGACATTGTCAGAAGCCTGCAGAATCAGAGGCCCCTATCAGAA       c.480
 L  V  E  H  L  V  D  I  V  R  S  L  Q  N  Q  R  P  L  S  E         p.160

          .         .         .       | 03 .         .         .    g.22030
 TCTGGACCAGACAACGAACTGAGCATCCTGGGCAAG | GCTTTTTCTTCTGGGGTGGATCTT    c.540
 S  G  P  D  N  E  L  S  I  L  G  K   | A  F  S  S  G  V  D  L      p.180

          .         .         .         .         .         .       g.22090
 TCCATGGCTTCTCCAAAGCTGGTGACTTCCGACACAGCTGCAGGGAAAATCAGAGATATT       c.600
 S  M  A  S  P  K  L  V  T  S  D  T  A  A  G  K  I  R  D  I         p.200

          .         .         .         .         .         .       g.22150
 CTCCATGACCTAGAAGAAATTCAGGAAAAATTACAAGAAAGCGTCACCTGGAAAGAGGCT       c.660
 L  H  D  L  E  E  I  Q  E  K  L  Q  E  S  V  T  W  K  E  A         p.220

          .          | 04        .         .         .         .    g.31345
 CCTGAAGCACAAATGCAGG | GAGAACTCCTGGAAGCCCCGTCTTCCTCCTCATGCCCATTG    c.720
 P  E  A  Q  M  Q  G |   E  L  L  E  A  P  S  S  S  S  C  P  L      p.240

          .         .         .         .          | 05        .    g.32735
 CCTGACCAGAGCCACCCTGCACTCAGGAGAGCTTCTCGGTTTGCTCAGT | GGGCCATCCAT    c.780
 P  D  Q  S  H  P  A  L  R  R  A  S  R  F  A  Q  W |   A  I  H      p.260

          .         .         .         .         .         .       g.32795
 CCAACCTTTAACTTGAAGAGCCTTTCCTGCAGCCTGGAGGTGTCCAAGGATTCCCGTACA       c.840
 P  T  F  N  L  K  S  L  S  C  S  L  E  V  S  K  D  S  R  T         p.280

          .         .         .         .         .         .       g.32855
 GTGACTGTGTCTCACCGCCCACAACCCTATCGCTGGAGCTGTGAGAGGTTTTCTACCAGC       c.900
 V  T  V  S  H  R  P  Q  P  Y  R  W  S  C  E  R  F  S  T  S         p.300

          .         .         .         .         .         .       g.32915
 CAGGTCTTATGTTCCCAGGCCCTGTCTTCTGGAAAGCATTACTGGGAAGTGGACACTAGG       c.960
 Q  V  L  C  S  Q  A  L  S  S  G  K  H  Y  W  E  V  D  T  R         p.320

          .         .         .         .         .         .       g.32975
 AATTGCAGCCACTGGGCAGTTGGGGTGGCTTCCTGGGAGATGAGCCGCGACCAGGTCCTG       c.1020
 N  C  S  H  W  A  V  G  V  A  S  W  E  M  S  R  D  Q  V  L         p.340

          .         .         .         .         .         .       g.33035
 GGAAGGACTATGGACTCTTGTTGTGTGGAATGGAAGGGGACTAGCCAGCTCTCTGCATGG       c.1080
 G  R  T  M  D  S  C  C  V  E  W  K  G  T  S  Q  L  S  A  W         p.360

          .         .         .         .         .         .       g.33095
 CACATGGTCAAGGAAACTGTCCTTGGCTCAGACAGACCTGGGGTGGTGGGCATCTGGCTG       c.1140
 H  M  V  K  E  T  V  L  G  S  D  R  P  G  V  V  G  I  W  L         p.380

          .         .         .         .         .         .       g.33155
 AACCTTGAGGAGGGAAAGCTTGCCTTCTATTCAGTGGACAATCAGGAGAAGCTTCTGTAT       c.1200
 N  L  E  E  G  K  L  A  F  Y  S  V  D  N  Q  E  K  L  L  Y         p.400

          .         .         .         .         .         .       g.33215
 GAGTGTACCATCTCTGCCTCCTCTCCTTTGTACCCTGCCTTCTGGCTGTATGGCTTACAT       c.1260
 E  C  T  I  S  A  S  S  P  L  Y  P  A  F  W  L  Y  G  L  H         p.420

          .         .         .                                     g.33254
 CCTGGAAATTACCTGATAATAAAGCAAGTAAAGGTGTAA                            c.1299
 P  G  N  Y  L  I  I  K  Q  V  K  V  X                              p.432

          .         .         .         .         .         .       g.33314
 ggtttcctaagggattacaacacagtggtttcctggtctctctccctgtcatcaatcagg       c.*60

          .         .         .         .         .         .       g.33374
 gtagtaacttgacttaagaataccactttttagaaaaattacgatagagatgggatctca       c.*120

          .         .         .         .         .         .       g.33434
 ctaggttgcccaggctggtgtcgaattcctggtctcaagcagtcctcccacctcagcctc       c.*180

          .         .         .         .         .         .       g.33494
 ccaaggtgctgggattacaggtgtgagccaccacacctggccaagaataccacttttgaa       c.*240

          .         .         .         .         .         .       g.33554
 gttaatccttttgtgtgatacaggatgaacttgggatgtttgaaccctggacattccaaa       c.*300

          .         .         .         .         .         .       g.33614
 taaagaataggcccctgcctggctcctgggagataacctctaagccattagaatatcttg       c.*360

          .         .         .         .         .         .       g.33674
 cctgataagagtgtttttgtttacctgtgggccttgggccatgcagtatcagcttgacct       c.*420

          .         .         .         .         .         .       g.33734
 tgcaaggtcaagctgaggagactaagttagccatgtgggcagtgaagcatgccaatgtga       c.*480

          .         .         .         .         .         .       g.33794
 tcaatccctagtaaaagccctggacacctaggcatgggtgagctactctggttggtaata       c.*540

          .         .         .         .         .         .       g.33854
 ctctgtgcacacatcattgtagccacacatcattgctgggagaattaagcattatcctga       c.*600

          .         .         .         .         .         .       g.33914
 agactctgccaggagaggataattggaagttctcttggaccttaccttatgtgcctttct       c.*660

          .         .         .         .         .                 g.33972
 tcattgctgattttaatctgtatcctttcactgtaataaactgtaactatgagtgcaa         c.*718

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Ring finger protein 135 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 19a
©2004-2017 Leiden University Medical Center