retinal pigment epithelium-specific protein 65kDa (RPE65) - coding DNA reference sequence

(used for variant description)

(last modified February 28, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_000329.2 in the RPE65 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008472.1, covering RPE65 transcript NM_000329.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5054
       tccttcttcattctgcagttggtgccagaactctggatcctgaactggaagaaa       c.-1

          .  | 02      .         .         .         .         .    g.6302
 ATGTCTATCCA | GGTTGAGCATCCTGCTGGTGGTTACAAGAAACTGTTTGAAACTGTGGAG    c.60
 M  S  I  Q  |  V  E  H  P  A  G  G  Y  K  K  L  F  E  T  V  E      p.20

          .         .         .     | 03   .         .         .    g.8125
 GAACTGTCCTCGCCGCTCACAGCTCATGTAACAG | GCAGGATCCCCCTCTGGCTCACCGGC    c.120
 E  L  S  S  P  L  T  A  H  V  T  G |   R  I  P  L  W  L  T  G      p.40

          .         .         .         .         .         .       g.8185
 AGTCTCCTTCGATGTGGGCCAGGACTCTTTGAAGTTGGATCTGAGCCATTTTACCACCTG       c.180
 S  L  L  R  C  G  P  G  L  F  E  V  G  S  E  P  F  Y  H  L         p.60

          .         .         .         .         .         .       g.8245
 TTTGATGGGCAAGCCCTCCTGCACAAGTTTGACTTTAAAGAAGGACATGTCACATACCAC       c.240
 F  D  G  Q  A  L  L  H  K  F  D  F  K  E  G  H  V  T  Y  H         p.80

       | 04  .         .         .         .         .         .    g.10131
 AGAAG | GTTCATCCGCACTGATGCTTACGTACGGGCAATGACTGAGAAAAGGATCGTCATA    c.300
 R  R  |  F  I  R  T  D  A  Y  V  R  A  M  T  E  K  R  I  V  I      p.100

          .         .         .         .         .    | 05    .    g.10294
 ACAGAATTTGGCACCTGTGCTTTCCCAGATCCCTGCAAGAATATATTTTCCAG | GTTTTTT    c.360
 T  E  F  G  T  C  A  F  P  D  P  C  K  N  I  F  S  R  |  F  F      p.120

          .         .         .         .         .         .       g.10354
 TCTTACTTTCGAGGAGTAGAGGTTACTGACAATGCCCTTGTTAATGTCTACCCAGTGGGG       c.420
 S  Y  F  R  G  V  E  V  T  D  N  A  L  V  N  V  Y  P  V  G         p.140

          .         .         .         .         .         .       g.10414
 GAAGATTACTACGCTTGCACAGAGACCAACTTTATTACAAAGATTAATCCAGAGACCTTG       c.480
 E  D  Y  Y  A  C  T  E  T  N  F  I  T  K  I  N  P  E  T  L         p.160

          .      | 06  .         .         .         .         .    g.14004
 GAGACAATTAAGCAG | GTTGATCTTTGCAACTATGTCTCTGTCAATGGGGCCACTGCTCAC    c.540
 E  T  I  K  Q   | V  D  L  C  N  Y  V  S  V  N  G  A  T  A  H      p.180

          .         .         .         .         .         .       g.14064
 CCCCACATTGAAAATGATGGAACCGTTTACAATATTGGTAATTGCTTTGGAAAAAATTTT       c.600
 P  H  I  E  N  D  G  T  V  Y  N  I  G  N  C  F  G  K  N  F         p.200

          .         .         .         .    | 07    .         .    g.15334
 TCAATTGCCTACAACATTGTAAAGATCCCACCACTGCAAGCAG | ACAAGGAAGATCCAATA    c.660
 S  I  A  Y  N  I  V  K  I  P  P  L  Q  A  D |   K  E  D  P  I      p.220

          .         .         .         .         .         .       g.15394
 AGCAAGTCAGAGATCGTTGTACAATTCCCCTGCAGTGACCGATTCAAGCCATCTTACGTT       c.720
 S  K  S  E  I  V  V  Q  F  P  C  S  D  R  F  K  P  S  Y  V         p.240

       | 08  .         .         .         .         .         .    g.15691
 CATAG | TTTTGGTCTGACTCCCAACTATATCGTTTTTGTGGAGACACCAGTCAAAATTAAC    c.780
 H  S  |  F  G  L  T  P  N  Y  I  V  F  V  E  T  P  V  K  I  N      p.260

          .         .         .         .         .         .       g.15751
 CTGTTCAAGTTCCTTTCTTCATGGAGTCTTTGGGGAGCCAACTACATGGATTGTTTTGAG       c.840
 L  F  K  F  L  S  S  W  S  L  W  G  A  N  Y  M  D  C  F  E         p.280

          .         | 09         .         .         .         .    g.15920
 TCCAATGAAACCATGGGG | GTTTGGCTTCATATTGCTGACAAAAAAAGGAAAAAGTACCTC    c.900
 S  N  E  T  M  G   | V  W  L  H  I  A  D  K  K  R  K  K  Y  L      p.300

          .         .         .         .         .         .       g.15980
 AATAATAAATACAGAACTTCTCCTTTCAACCTCTTCCATCACATCAACACCTATGAAGAC       c.960
 N  N  K  Y  R  T  S  P  F  N  L  F  H  H  I  N  T  Y  E  D         p.320

          .         .         .         | 10         .         .    g.16665
 AATGGGTTTCTGATTGTGGATCTCTGCTGCTGGAAAGG | ATTTGAGTTTGTTTATAATTAC    c.1020
 N  G  F  L  I  V  D  L  C  C  W  K  G  |  F  E  F  V  Y  N  Y      p.340

          .         .         .         .         .         .       g.16725
 TTATATTTAGCCAATTTACGTGAGAACTGGGAAGAGGTGAAAAAAAATGCCAGAAAGGCT       c.1080
 L  Y  L  A  N  L  R  E  N  W  E  E  V  K  K  N  A  R  K  A         p.360

          .         .         .         .         | 11         .    g.23386
 CCCCAACCTGAAGTTAGGAGATATGTACTTCCTTTGAATATTGACAAG | GCTGACACAGGC    c.1140
 P  Q  P  E  V  R  R  Y  V  L  P  L  N  I  D  K   | A  D  T  G      p.380

          .         .         .         .         .         .       g.23446
 AAGAATTTAGTCACGCTCCCCAATACAACTGCCACTGCAATTCTGTGCAGTGACGAGACT       c.1200
 K  N  L  V  T  L  P  N  T  T  A  T  A  I  L  C  S  D  E  T         p.400

          .         .         .         .    | 12    .         .    g.23600
 ATCTGGCTGGAGCCTGAAGTTCTCTTTTCAGGGCCTCGTCAAG | CATTTGAGTTTCCTCAA    c.1260
 I  W  L  E  P  E  V  L  F  S  G  P  R  Q  A |   F  E  F  P  Q      p.420

          .         .         .         .         .         .       g.23660
 ATCAATTACCAGAAGTATTGTGGGAAACCTTACACATATGCGTATGGACTTGGCTTGAAT       c.1320
 I  N  Y  Q  K  Y  C  G  K  P  Y  T  Y  A  Y  G  L  G  L  N         p.440

          .         | 13         .         .         .         .    g.23825
 CACTTTGTTCCAGATAGG | CTCTGTAAGCTGAATGTCAAAACTAAAGAAACTTGGGTTTGG    c.1380
 H  F  V  P  D  R   | L  C  K  L  N  V  K  T  K  E  T  W  V  W      p.460

          .         .         .         .         .         .       g.23885
 CAAGAGCCTGATTCATACCCATCAGAACCCATCTTTGTTTCTCACCCAGATGCCTTGGAA       c.1440
 Q  E  P  D  S  Y  P  S  E  P  I  F  V  S  H  P  D  A  L  E         p.480

          . | 14       .         .         .         .         .    g.25082
 GAAGATGATG | GTGTAGTTCTGAGTGTGGTGGTGAGCCCAGGAGCAGGACAAAAGCCTGCT    c.1500
 E  D  D  G |   V  V  L  S  V  V  V  S  P  G  A  G  Q  K  P  A      p.500

          .         .         .         .         .         .       g.25142
 TATCTCCTGATTCTGAATGCCAAGGACTTAAGTGAAGTTGCCCGGGCTGAAGTGGAGATT       c.1560
 Y  L  L  I  L  N  A  K  D  L  S  E  V  A  R  A  E  V  E  I         p.520

          .         .         .         .                           g.25184
 AACATCCCTGTCACCTTTCATGGACTGTTCAAAAAATCTTGA                         c.1602
 N  I  P  V  T  F  H  G  L  F  K  K  S  X                           p.533

          .         .         .         .         .         .       g.25244
 gcatactccagcaagatatgtttttggtagcaaaactgagaaaatcagcttcaggtctgc       c.*60

          .         .         .         .         .         .       g.25304
 aatcaaattctgttcaattttagcctgctatatgtcatggttttaacttgcagatgcgca       c.*120

          .         .         .         .         .         .       g.25364
 caattttgcaatgttttacagaaagcactgagttgagcaagcaattcctttatttaaaaa       c.*180

          .         .         .         .         .         .       g.25424
 aaaaagtacgtatttagataatcatacttcctctgtgagacaggccataactgaaaaact       c.*240

          .         .         .         .         .         .       g.25484
 cttaaatatttagcaatcaaataggaaatgaatgtggacttactaaatggcttttaattc       c.*300

          .         .         .         .         .         .       g.25544
 ctattataagagcatattttaggtacctatctgctccaattatatttttaacatttaaaa       c.*360

          .         .         .         .         .         .       g.25604
 accaaagtcctctacacttgatttatattatatgtggctttgctgagtcaaggaagtatc       c.*420

          .         .         .         .         .         .       g.25664
 atgcaataaggcttaattactaaatgtcaaaccaaactttttctcaaaccagggactatc       c.*480

          .         .         .         .         .         .       g.25724
 atctaagattaattacagtaattattttgcgtatacgtaactgctcaaagattatgaatc       c.*540

          .         .         .         .         .         .       g.25784
 ttatgaatgttaacctttccgtttattacaagcaagtactattatttctgattttataat       c.*600

          .         .         .         .         .         .       g.25844
 aagaaaatctgtgtttaatcaactgaggcctctcaaccaaataacatctcagagattaag       c.*660

          .         .         .         .         .         .       g.25904
 ttatatattaaaagcttatgtaacataaaagcaagtacatatagtagtgactatatttaa       c.*720

          .         .         .         .         .         .       g.25964
 aaaaacagcataaaatgcttaaaaatgtaatatttactaaaatcagattatgggataatg       c.*780

          .         .         .         .         .         .       g.26024
 ttgcaggattatactttattgcatcttttttgtttaattgtatttaagcattgtgcaatc       c.*840

          .         .         .         .         .         .       g.26084
 acttgggaaaaatattaaattattaacattgaggtattaatacattttaagccttttgtt       c.*900

          .         .         .         .         .                 g.26136
 tttaaatttcttttcttccagagattgtttaaaaataaatattgacaaaaat               c.*952

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Retinal pigment epithelium-specific protein 65kDa protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center