ribosomal protein L10 (RPL10) - coding DNA reference sequence

(used for variant description)

(last modified September 4, 2017)

This file was created to facilitate the description of sequence variants on transcript NM_006013.3 in the RPL10 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012890.1, covering RPL10 transcript NM_006013.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.5008
                                                     gggctacg       c.-181

 .         .         .         .         .         .                g.5068
 cccgggcgcaagcgccaagagcggctgcgtctatggtcatgacgtctgacagagcgtcca       c.-121

 .         .         .         .         .         .                g.5128
 cccgtcttcgacaggactctatggttcttacgcgcgcagacagaccgcctatataagcca       c.-61

 .         .         .         .       | 02 .         .             g.5290
 tgcgcaggcggaggagcgcctctttcccttcggtgtg | ccactgaagatcctggtgtcgcc    c.-1

          .         .    | 03    .         .         .         .    g.6145
 ATGGGCCGCCGCCCCGCCCGTTG | TTACCGGTATTGTAAGAACAAGCCGTACCCAAAGTCT    c.60
 M  G  R  R  P  A  R  C  |  Y  R  Y  C  K  N  K  P  Y  P  K  S      p.20

          .         .   | 04     .         .         .         .    g.6295
 CGCTTCTGCCGAGGTGTCCCTG | ATGCCAAGATTCGCATTTTTGACCTGGGGCGGAAAAAG    c.120
 R  F  C  R  G  V  P  D |   A  K  I  R  I  F  D  L  G  R  K  K      p.40

          .         .         .         .         .         .       g.6355
 GCAAAAGTGGATGAGTTTCCGCTTTGTGGCCACATGGTGTCAGATGAATATGAGCAGCTG       c.180
 A  K  V  D  E  F  P  L  C  G  H  M  V  S  D  E  Y  E  Q  L         p.60

          . | 05       .         .         .         .         .    g.6623
 TCCTCTGAAG | CCCTGGAGGCTGCCCGAATTTGTGCCAATAAGTACATGGTAAAAAGTTGT    c.240
 S  S  E  A |   L  E  A  A  R  I  C  A  N  K  Y  M  V  K  S  C      p.80

          .         .         .         .         .         .       g.6683
 GGCAAAGATGGCTTCCATATCCGGGTGCGGCTCCACCCCTTCCACGTCATCCGCATCAAC       c.300
 G  K  D  G  F  H  I  R  V  R  L  H  P  F  H  V  I  R  I  N         p.100

          .         .          | 06        .         .         .    g.7265
 AAGATGTTGTCCTGTGCTGGGGCTGACAG | GCTCCAAACAGGCATGCGAGGTGCCTTTGGA    c.360
 K  M  L  S  C  A  G  A  D  R  |  L  Q  T  G  M  R  G  A  F  G      p.120

          .         .         .         .         .         .       g.7325
 AAGCCCCAGGGCACTGTGGCCAGGGTTCACATTGGCCAAGTTATCATGTCCATCCGCACC       c.420
 K  P  Q  G  T  V  A  R  V  H  I  G  Q  V  I  M  S  I  R  T         p.140

          .         .         .         .         .         .       g.7385
 AAGCTGCAGAACAAGGAGCATGTGATTGAGGCCCTGCGCAGGGCCAAGTTCAAGTTTCCT       c.480
 K  L  Q  N  K  E  H  V  I  E  A  L  R  R  A  K  F  K  F  P         p.160

          .   | 07     .         .         .         .         .    g.7520
 GGCCGCCAGAAG | ATCCACATCTCAAAGAAGTGGGGCTTCACCAAGTTCAATGCTGATGAA    c.540
 G  R  Q  K   | I  H  I  S  K  K  W  G  F  T  K  F  N  A  D  E      p.180

          .         .         .         .         .         .       g.7580
 TTTGAAGACATGGTGGCTGAAAAGCGGCTCATCCCAGATGGCTGTGGGGTCAAGTACATC       c.600
 F  E  D  M  V  A  E  K  R  L  I  P  D  G  C  G  V  K  Y  I         p.200

          .         .         .         .                           g.7625
 CCCAATCGTGGCCCTCTGGACAAGTGGCGGGCCCTGCACTCATGA                      c.645
 P  N  R  G  P  L  D  K  W  R  A  L  H  S  X                        p.214

          .         .         .         .         .         .       g.7685
 gggcttccaatgtgctgcccccctcttaatactcaccaataaattctacttcctgtccac       c.*60

          .         .         .         .         .         .       g.7745
 ctatgtctttgtatctacattcttgacggggaaggaacttcctctgggaacctttgggtc       c.*120

          .         .         .         .         .         .       g.7805
 attgccctttcacttcagaaacaggttgacaactcagccctgctcatgaggcagcaaacc       c.*180

          .         .         .         .         .         .       g.7865
 ctgcaaagggctgggactggtggccttatgtcagttgtctactctggagcttgacttgga       c.*240

          .         .         .         .         .         .       g.7925
 cctccccaggtcctaggcagtaggttgaaaaacactgaagtgcttttcatgaagcacagc       c.*300

          .         .         .         .         .         .       g.7985
 tgcagcaaagccttgcaatcccaggctggggtcagcctacagttgtgttgcttattacaa       c.*360

          .         .         .         .         .         .       g.8045
 cacatgcggaccaagaggggcttgtgggctagaggctgaccagcagcgtttatttagcaa       c.*420

          .         .         .         .         .         .       g.8105
 gggtaggtgtgcatcacattgggcttgttctcacccatctggtttggccattcctccttg       c.*480

          .         .         .         .         .         .       g.8165
 gtgggaatcatccaggtactgctgaggtcacctgcgatttgccccatttcctatctctag       c.*540

          .         .         .         .         .         .       g.8225
 caacctcctgggccccatgcccccaccccttctagaacctgcattcccagggccttcacc       c.*600

          .         .         .         .         .         .       g.8285
 acctgaccaaaggtctaggctaacctttggtcatttgtaacaagacctcggaacagacac       c.*660

          .         .         .         .         .         .       g.8345
 gtgtgtggcatggtttggcctggggatcttagatgtctgacctgaactattgtagaacag       c.*720

          .         .         .         .         .         .       g.8405
 cgctggcttttgggggagcagcaaaaatgagaggagtgctaggtgggtggcctgagcatc       c.*780

          .         .         .         .         .         .       g.8465
 tgtatccagggacaggactccaaaggcttttggtcccagagctggggtatgttggcccca       c.*840

          .         .         .         .         .         .       g.8525
 gcccccagcctgtggctcccaaaaggcctctggttttttgtaatctcagtttacagccat       c.*900

          .         .         .         .         .         .       g.8585
 ttcttaggtttttaattacctttattttattttgccaaacatacctgggaatacctttta       c.*960

          .         .         .         .         .         .       g.8645
 ttttttttttaccttggggtgatggttccaaaccataaatgtgattatagttaacacatg       c.*1020

          .         .         .         .         .         .       g.8705
 acccttctagcgtcccagccagtgtttttcctgacctctgttctttggagaggaggatgg       c.*1080

          .         .         .         .         .         .       g.8765
 aagggaggggtccggcacgctgctggcattttgctgtgtcctgcagcccctttccgggac       c.*1140

          .         .         .         .         .         .       g.8825
 acctgggttcacacagctttttagcttacataactggtgcagattttctgtgtggagatg       c.*1200

          .         .         .         .         .         .       g.8885
 ttgccttgaccagccttggctggactttaccaggcatgcagaagcctgtaccaacacaga       c.*1260

          .         .         .         .         .         .       g.8945
 ctacagcacccaggaggtgcgagtgtggctgctcagcggttataacaggcctgactgcat       c.*1320

          .         .         .         .         .         .       g.9005
 tgttcaccggattataatgagccaaaatgtttcccggtgtttgctggtttcagggaagga       c.*1380

          .         .         .         .         .         .       g.9065
 gtttgatatagcagattaaccaccctccttgtagctattggggcttaatggtttcctggt       c.*1440

          .         .         .         .                           g.9110
 gattcttaccaatccacaataaacatggcccattggcatatctgc                      c.*1485

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ribosomal protein L10 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.