ribosomal protein L15 (RPL15) - coding DNA reference sequence

(used for variant description)

(last modified December 29, 2018)


This file was created to facilitate the description of sequence variants on transcript NM_002948.3 in the RPL15 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_033850.2, covering RPL15 transcript NM_002948.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5020
                                         aaagacagcggctccaccgc       c.-361

 .         .         .         .         .         .                g.5080
 ggtacgcggccaccggctttggagcctggaccccaacttgcctcctctcgcggagagaca       c.-301

 .         .         .         .         .         .                g.5140
 gtcgccgacgctcgcttagccgccgagacctcgccgccaactctctcacctctcgagacg       c.-241

 .         .         .         .         .         .                g.5200
 cccaggccgctcaggctcgaatcttgcggagcagggggcgggacaatagcggccgcggcg       c.-181

 .         .         .         .         .         .                g.5260
 ccccactcggcagaactccgccaccaggcgcgatgccggaactacatgtcccatgacgct       c.-121

 .         .         .         .         .         .                g.5320
 ctgggaggccgcagctttccaccggaaagagggtggctgaggtgggggaggagcccaaaa       c.-61

 .         .         .         .         .          | 02            g.6056
 ggcattgtgggagtacagctctttcctttccgtctggcggcagccatcag | gtaagccaag    c.-1

          .         .         .         .         .         .       g.6116
 ATGGGTGCATACAAGTACATCCAGGAGCTATGGAGAAAGAAGCAGTCTGATGTCATGCGC       c.60
 M  G  A  Y  K  Y  I  Q  E  L  W  R  K  K  Q  S  D  V  M  R         p.20

          .         .         .         .         .         .       g.6176
 TTTCTTCTGAGGGTCCGCTGCTGGCAGTACCGCCAGCTCTCTGCTCTCCACAGGGCTCCC       c.120
 F  L  L  R  V  R  C  W  Q  Y  R  Q  L  S  A  L  H  R  A  P         p.40

          .         .         .         .         .   | 03     .    g.6644
 CGCCCCACCCGGCCTGATAAAGCGCGCCGACTGGGCTACAAGGCCAAGCAAG | GTTACGTT    c.180
 R  P  T  R  P  D  K  A  R  R  L  G  Y  K  A  K  Q  G |   Y  V      p.60

          .         .         .         .         .         .       g.6704
 ATATATAGGATTCGTGTTCGCCGTGGTGGCCGAAAACGCCCAGTTCCTAAGGGTGCAACT       c.240
 I  Y  R  I  R  V  R  R  G  G  R  K  R  P  V  P  K  G  A  T         p.80

          .         .         .         .         .         .       g.6764
 TACGGCAAGCCTGTCCATCATGGTGTTAACCAGCTAAAGTTTGCTCGAAGCCTTCAGTCC       c.300
 Y  G  K  P  V  H  H  G  V  N  Q  L  K  F  A  R  S  L  Q  S         p.100

           | 04        .         .         .         .         .    g.7443
 GTTGCAGAG | GAGCGAGCTGGACGCCACTGTGGGGCTCTGAGAGTCCTGAATTCTTACTGG    c.360
 V  A  E   | E  R  A  G  R  H  C  G  A  L  R  V  L  N  S  Y  W      p.120

          .         .         .         .         .         .       g.7503
 GTTGGTGAAGATTCCACATACAAATTTTTTGAGGTTATCCTCATTGATCCATTCCATAAA       c.420
 V  G  E  D  S  T  Y  K  F  F  E  V  I  L  I  D  P  F  H  K         p.140

          .         .         .         .         .         .       g.7563
 GCTATCAGAAGAAATCCTGACACCCAGTGGATCACCAAACCAGTCCACAAGCACAGGGAG       c.480
 A  I  R  R  N  P  D  T  Q  W  I  T  K  P  V  H  K  H  R  E         p.160

          .         .         .         .         .         .       g.7623
 ATGCGTGGGCTGACATCTGCAGGCCGAAAGAGCCGTGGCCTTGGAAAGGGCCACAAGTTC       c.540
 M  R  G  L  T  S  A  G  R  K  S  R  G  L  G  K  G  H  K  F         p.180

          .         .         .         .         .         .       g.7683
 CACCACACTATTGGTGGCTCTCGCCGGGCAGCTTGGAGAAGGCGCAATACTCTCCAGCTC       c.600
 H  H  T  I  G  G  S  R  R  A  A  W  R  R  R  N  T  L  Q  L         p.200

          .                                                         g.7698
 CACCGTTACCGCTAA                                                    c.615
 H  R  Y  R  X                                                      p.204

          .         .         .         .         .         .       g.7758
 tataagtaaagtttgtaaaattcatacttaataaacaatttaggacagtcatgtctgctt       c.*60

          .         .         .         .         .         .       g.7818
 acaggtgttatttgtctgttaaaactagtctgcagatgtttcttgaatgctttgtcaaat       c.*120

          .         .         .         .         .         .       g.7878
 taagaaagttaaagtgcaataatgtttgaagacaataagtggtggtgtatcttgtttcta       c.*180

          .         .         .         .         .         .       g.7938
 ataagataaacttttttgtctttgctttatcttattagggagttgtatgtcagtgtataa       c.*240

          .         .         .         .         .         .       g.7998
 aacatactgtgtggtataacaggcttaataaattctttaaaaggagagaactgaaactag       c.*300

          .         .         .         .         .         .       g.8058
 ccctgtagatttgtctggtgcatgtgatgaaacctgcagctttatcggagtgatggcaat       c.*360

          .         .         .         .         .         .       g.8118
 gctctgctggtttattttcaagtggctgcgttttttttagtttggcaggtgtagactttt       c.*420

          .         .         .         .         .         .       g.8178
 taagttgggctttagaaaatctgggttagcctgaagaaaattgcctcagcctccacagta       c.*480

          .         .         .         .         .         .       g.8238
 ccattttaaattcacataaaaggtgaaagctcctggttcagtgccatggcttcatggcat       c.*540

          .         .         .         .         .         .       g.8298
 tcagtgattagtggtaatggtaaacactggtgtgttttgaagttgaatgtgcgataaaat       c.*600

          .         .         .         .         .         .       g.8358
 tattagccttaagattggtaagctagcaatgaatgctagggtgggaagctggtgagccag       c.*660

          .         .         .         .         .         .       g.8418
 tggccattagataaatacctttcaagtgtgagcttagacgtcaaccctaaaatacttaac       c.*720

          .         .         .         .         .         .       g.8478
 cgtaatgctaattgtgatcattatgaatcccttcagtcacattagggggaaagtagttgg       c.*780

          .         .         .         .         .         .       g.8538
 ctataagtacgtcattcttagtccagtcagtcttaaaaacatcttgggttacccactctg       c.*840

          .         .         .         .         .         .       g.8598
 tccactcccataggctacagaaaaagtcacaagcgcatggtttccaaccatatgtgtttt       c.*900

          .         .         .         .         .         .       g.8658
 ctgcagttatttctcttgttctggccaaacaaccctaaaaatccttaccattccacaaag       c.*960

          .         .         .         .         .         .       g.8718
 ttggaccatcacttgtgcacccactttgactatgagtataccaccacattgcatttctgt       c.*1020

          .         .         .         .         .         .       g.8778
 ttgcaccatgtcttccaggagactagactactgttgtccagggtcaatttgagtgtaaag       c.*1080

          .         .         .         .         .         .       g.8838
 aaaatgtagacaaggaattgcccaattttaaattctgactttgctgacttaatttaaatg       c.*1140

          .         .         .         .         .         .       g.8898
 ctcgttctgaaccaattttctcctatcttctctaggggtttcaaaagactcagttaattg       c.*1200

          .         .         .         .         .         .       g.8958
 atttccaggaagtactcatagcaagttcataaaagttcttgagacctaaatttcttcaca       c.*1260

          .         .         .         .         .         .       g.9018
 aaaaaagaaaagatcttaagtcatacattttaattgtgtagaggttgttcaactgaagga       c.*1320

          .         .         .                                     g.9053
 ataaatgtctattaaactaaaacaaatggaccttc                                c.*1355

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Ribosomal protein L15 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21
©2004-2018 Leiden University Medical Center