ribosomal protein L26 (RPL26) - coding DNA reference sequence

(used for variant description)

(last modified July 4, 2017)

This file was created to facilitate the description of sequence variants on transcript NM_000987.3 in the RPL26 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_031989.1, covering RPL26 transcript NM_000987.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5036
                         ataggtctcgcgagatctttggtaaacttacagaac       c.-61

 .         .         .         .         .         .     | 02       g.5937
 cggaagcagcgtgtagttctcttcccttttgcggccatcaccgaagcgggagcgg | ccaaa    c.-1

          .         .         .         .         .         .       g.5997
 ATGAAGTTTAATCCCTTTGTGACTTCCGACCGAAGCAAGAATCGCAAAAGGCATTTCAAT       c.60
 M  K  F  N  P  F  V  T  S  D  R  S  K  N  R  K  R  H  F  N         p.20

          .         .         .         .         .         .       g.6057
 GCACCTTCCCACATTCGAAGGAAGATTATGTCTTCCCCTCTTTCCAAAGAGCTGAGACAG       c.120
 A  P  S  H  I  R  R  K  I  M  S  S  P  L  S  K  E  L  R  Q         p.40

          .         .         .         .         | 03         .    g.8323
 AAGTACAACGTGCGATCCATGCCCATCCGAAAGGATGATGAAGTTCAG | GTTGTACGTGGA    c.180
 K  Y  N  V  R  S  M  P  I  R  K  D  D  E  V  Q   | V  V  R  G      p.60

          .         .         .         .         .         .       g.8383
 CACTATAAAGGTCAGCAAATTGGCAAAGTAGTCCAGGTTTACAGGAAGAAATATGTTATC       c.240
 H  Y  K  G  Q  Q  I  G  K  V  V  Q  V  Y  R  K  K  Y  V  I         p.80

          .         .         .         .         .         .       g.8443
 TACATTGAACGGGTGCAGCGGGAAAAGGCTAATGGCACAACTGTCCACGTAGGCATTCAC       c.300
 Y  I  E  R  V  Q  R  E  K  A  N  G  T  T  V  H  V  G  I  H         p.100

           | 04        .         .         .         .         .    g.10606
 CCCAGCAAG | GTGGTTATCACTAGGCTAAAACTGGACAAAGACCGCAAAAAGATCCTCGAA    c.360
 P  S  K   | V  V  I  T  R  L  K  L  D  K  D  R  K  K  I  L  E      p.120

          .         .         .         .         .         .       g.10666
 CGGAAAGCCAAATCTCGCCAAGTAGGAAAGGAAAAGGGCAAATACAAGGAAGAAACCATT       c.420
 R  K  A  K  S  R  Q  V  G  K  E  K  G  K  Y  K  E  E  T  I         p.140

          .                                                         g.10684
 GAGAAGATGCAGGAATAA                                                 c.438
 E  K  M  Q  E  X                                                   p.145

          .         .         .         .                           g.10732
 agtaatcttatatacaagctttgattaaaacttgaaacaaagagcctg                   c.*48

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ribosomal protein L26 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.