ribosomal protein S10 (RPS10) - coding DNA reference sequence

(used for variant description)

(last modified April 20, 2021)

This file was created to facilitate the description of sequence variants on transcript NM_001203245.2 in the RPS10 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000006.11, covering RPS10 transcript NM_001203245.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.5090
                                                       agccgc       c.-241

 .         .         .         .         .         .                g.5150
 agaggtgagtttctgtggcgttcgagttccatcggctcccatccgggctatcctgccgcc       c.-181

 .         .         .         .         .         .                g.5210
 ttagcggctgcttctccccaggatgcgggcagggggcctctctcccactccccacacacc       c.-121

 .         .         .         .         .         .                g.5270
 gatttctgagtagcgataggggctggaggcttattttatggggtagggggccgctggtag       c.-61

 .         .         .         .         .         .                g.5330
 gcgaagattgtccgagggagagggggaggatgaagccagtgagtggcggagacttgccag       c.-1

  | 02       .         .         .         .         .         .    g.5964
  | ATGTTGATGCCTAAGAAGAACCGGATTGCCATTTATGAACTCCTTTTTAAGGAGGGAGTC    c.60
  | M  L  M  P  K  K  N  R  I  A  I  Y  E  L  L  F  K  E  G  V      p.20

          .         .         .         .         .         .       g.6024
 ATGGTGGCCAAGAAGGATGTCCACATGCCTAAGCACCCGGAGCTGGCAGACAAGAATGTG       c.120
 M  V  A  K  K  D  V  H  M  P  K  H  P  E  L  A  D  K  N  V         p.40

          .         .         . | 03       .         .         .    g.6315
 CCCAACCTTCATGTCATGAAGGCCATGCAG | TCTCTCAAGTCCCGAGGCTACGTGAAGGAA    c.180
 P  N  L  H  V  M  K  A  M  Q   | S  L  K  S  R  G  Y  V  K  E      p.60

          .         .         .         .         .         .       g.6375
 CAGTTTGCCTGGAGACATTTCTACTGGTACCTTACCAATGAGGGTATCCAGTATCTCCGT       c.240
 Q  F  A  W  R  H  F  Y  W  Y  L  T  N  E  G  I  Q  Y  L  R         p.80

          .         .         .         .         .         .       g.6435
 GATTACCTTCATCTGCCCCCGGAGATTGTGCCTGCCACCCTACGCCGTAGCCGTCCAGAG       c.300
 D  Y  L  H  L  P  P  E  I  V  P  A  T  L  R  R  S  R  P  E         p.100

          .         .   | 04     .         .         .         .    g.9356
 ACTGGCAGGCCTCGGCCTAAAG | GTCTGGAGGGTGAGCGACCTGCGAGACTCACAAGAGGG    c.360
 T  G  R  P  R  P  K  G |   L  E  G  E  R  P  A  R  L  T  R  G      p.120

          .         .         .         . | 05       .         .    g.12721
 GAAGCTGACAGAGATACCTACAGACGGAGTGCTGTGCCAC | CTGGTGCCGACAAGAAAGCC    c.420
 E  A  D  R  D  T  Y  R  R  S  A  V  P  P |   G  A  D  K  K  A      p.140

          .         .         .       | 06 .         .         .    g.13602
 GAGGCTGGGGCTGGGTCAGCAACCGAATTCCAGTTT | AGAGGCGGATTTGGTCGTGGACGT    c.480
 E  A  G  A  G  S  A  T  E  F  Q  F   | R  G  G  F  G  R  G  R      p.160

          .                                                         g.13620
 GGTCAGCCACCTCAGTAA                                                 c.498
 G  Q  P  P  Q  X                                                   p.165

          .         .         .         .         .                 g.13672
 aattggagaggattcttttgcattgaataaacttacagccaaaaaaccttaa               c.*52

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ribosomal protein S10 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.