ribosomal protein S17 (RPS17) - coding DNA reference sequence

(used for variant description)

(last modified April 20, 2021)

This file was created to facilitate the description of sequence variants on transcript NM_001021.3 in the RPS17 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000015.9, covering RPS17 transcript NM_001021.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.4809
                                gtttcctcttttaccaaggacccgccaac       c.-1

     | 02    .         .         .         .         .         .    g.5162
 ATG | GGCCGCGTTCGCACCAAAACCGTGAAGAAGGCGGCCCGGGTCATCATAGAAAAGTAC    c.60
 M   | G  R  V  R  T  K  T  V  K  K  A  A  R  V  I  I  E  K  Y      p.20

          .         .         .         .         .         .       g.5222
 TACACGCGCCTGGGCAACGACTTCCACACGAACAAGCGCGTGTGCGAGGAGATCGCCATT       c.120
 Y  T  R  L  G  N  D  F  H  T  N  K  R  V  C  E  E  I  A  I         p.40

          .         .         .      | 03  .         .         .    g.6277
 ATCCCCAGCAAAAAGCTCCGCAACAAGATAGCAGG | TTATGTCACGCATCTGATGAAGCGA    c.180
 I  P  S  K  K  L  R  N  K  I  A  G  |  Y  V  T  H  L  M  K  R      p.60

          .         .         .         .         .         .       g.6337
 ATTCAGAGAGGCCCAGTAAGAGGTATCTCCATCAAGCTGCAGGAGGAGGAGAGAGAAAGG       c.240
 I  Q  R  G  P  V  R  G  I  S  I  K  L  Q  E  E  E  R  E  R         p.80

          .         .  | 04      .         .         .         .    g.6905
 AGAGACAATTATGTTCCTGAG | GTCTCAGCCTTGGATCAGGAGATTATTGAAGTAGATCCT    c.300
 R  D  N  Y  V  P  E   | V  S  A  L  D  Q  E  I  I  E  V  D  P      p.100

          .         .        | 05.         .         .         .    g.8389
 GACACTAAGGAAATGCTGAAGCTTTTG | GACTTCGGCAGTCTGTCCAACCTTCAGGTCACT    c.360
 D  T  K  E  M  L  K  L  L   | D  F  G  S  L  S  N  L  Q  V  T      p.120

          .         .         .         .                           g.8437
 CAGCCTACAGTTGGGATGAATTTCAAAACGCCTCGGGGACCTGTTTGA                   c.408
 Q  P  T  V  G  M  N  F  K  T  P  R  G  P  V  X                     p.135

          .         .         .         .                           g.8485
 attttttctgtagtgctgtattattttcaataaatctgggacaacagc                   c.*48

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ribosomal protein S17 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.