ribosomal protein S27a (RPS27A) - coding DNA reference sequence

(used for variant description)

(last modified April 22, 2021)

This file was created to facilitate the description of sequence variants on transcript NM_001135592.2 in the RPS27A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000002.11, covering RPS27A transcript NM_001135592.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5043
                  aagacccagactcttccctaggctgggagagactcggcggttg       c.-181

 .         .         .         .         .         .                g.5103
 aaagcagggaggcgctacaggagagaaagggctgaacccccgcttccgcagatttcacct       c.-121

 .         .         .         .         .         .                g.5163
 atttttcagtttgcctggagcaggccacgcaaattcccttcccttgaaggcccaaggagc       c.-61

 .         .         .         .         .   | 02     .             g.5922
 gtctggtagattgctgattctctgcccatcaccgcttctggaa | gtggagccgccaccaaa    c.-1

          .         .         .         .         | 03         .    g.6472
 ATGCAGATTTTCGTGAAAACCCTTACGGGGAAGACCATCACCCTCGAG | GTTGAACCCTCG    c.60
 M  Q  I  F  V  K  T  L  T  G  K  T  I  T  L  E   | V  E  P  S      p.20

          .         .         .         .    | 04    .         .    g.7233
 GATACGATAGAAAATGTAAAGGCCAAGATCCAGGATAAGGAAG | GAATTCCTCCTGATCAG    c.120
 D  T  I  E  N  V  K  A  K  I  Q  D  K  E  G |   I  P  P  D  Q      p.40

          .         .         .         .         .         .       g.7293
 CAGAGACTGATCTTTGCTGGCAAGCAGCTGGAAGATGGACGTACTTTGTCTGACTACAAT       c.180
 Q  R  L  I  F  A  G  K  Q  L  E  D  G  R  T  L  S  D  Y  N         p.60

           | 05        .         .         .         .         .    g.7979
 ATTCAAAAG | GAGTCTACTCTTCATCTTGTGTTGAGACTTCGTGGTGGTGCTAAGAAAAGG    c.240
 I  Q  K   | E  S  T  L  H  L  V  L  R  L  R  G  G  A  K  K  R      p.80

          .         .         .         .         .         .       g.8039
 AAGAAGAAGTCTTACACCACTCCCAAGAAGAATAAGCACAAGAGAAAGAAGGTTAAGCTG       c.300
 K  K  K  S  Y  T  T  P  K  K  N  K  H  K  R  K  K  V  K  L         p.100

          .         .  | 06      .         .         .         .    g.8564
 GCTGTCCTGAAATATTATAAG | GTGGATGAGAATGGCAAAATTAGTCGCCTTCGTCGAGAG    c.360
 A  V  L  K  Y  Y  K   | V  D  E  N  G  K  I  S  R  L  R  R  E      p.120

          .         .         .         .         .         .       g.8624
 TGCCCTTCTGATGAATGTGGTGCTGGGGTGTTTATGGCAAGTCACTTTGACAGACATTAT       c.420
 C  P  S  D  E  C  G  A  G  V  F  M  A  S  H  F  D  R  H  Y         p.140

          .         .         .         .         .                 g.8675
 TGTGGCAAATGTTGTCTGACTTACTGTTTCAACAAACCAGAAGACAAGTAA                c.471
 C  G  K  C  C  L  T  Y  C  F  N  K  P  E  D  K  X                  p.156

          .         .         .         .         .         .       g.8735
 ctgtatgagttaataaaagacatgaactaacatttattgttgggttttattgcagtaaaa       c.*60

          .         .         .         .         .         .       g.8795
 agaatggtttttaagcaccaaattgatggtcacaccatttccttttagtagtgctactgc       c.*120

          .         .         .         .         .         .       g.8855
 tatcgctgtgtgaatgttgcctctggggattatgtgacccagtggttctgtatacctgcc       c.*180

          .         .         .         .         .         .       g.8915
 aggtgccaaccacttgtaaaggtcttgatattttcaattcttagactacctatactttgg       c.*240

          .         .         .                                     g.8951
 cagaagttatatttaatgtaagttgtctaaatataa                               c.*276

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ribosomal protein S27a protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.