ribosomal protein S6 kinase, 90kDa, polypeptide 3 (RPS6KA3) - coding DNA reference sequence

(used for variant description)

(last modified February 13, 2018)


This file was created to facilitate the description of sequence variants on transcript NM_004586.2 in the RPS6KA3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007488.1, covering RPS6KA3 transcript NM_004586.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
          .         .         .         .         .         .       g.60
 ATGCCGCTGGCGCAGCTGGCGGACCCGTGGCAGAAGATGGCTGTGGAGAGCCCGTCCGAC       c.60
 M  P  L  A  Q  L  A  D  P  W  Q  K  M  A  V  E  S  P  S  D         p.20

           | 02        .         .         .         .         .    g.31869
 AGCGCTGAG | AATGGACAGCAAATTATGGATGAACCTATGGGAGAGGAGGAGATTAACCCA    c.120
 S  A  E   | N  G  Q  Q  I  M  D  E  P  M  G  E  E  E  I  N  P      p.40

        | 03 .         .         .         .         .         .    g.57282
 CAAACT | GAAGAAGTCAGTATCAAAGAAATTGCAATCACACATCATGTAAAGGAAGGACAT    c.180
 Q  T   | E  E  V  S  I  K  E  I  A  I  T  H  H  V  K  E  G  H      p.60

          .         .         .         .         .         .       g.57342
 GAAAAGGCAGATCCTTCCCAGTTTGAACTTTTAAAAGTATTAGGGCAGGGATCATTTGGA       c.240
 E  K  A  D  P  S  Q  F  E  L  L  K  V  L  G  Q  G  S  F  G         p.80

     | 04    .         .         .         .         .         .    g.62586
 AAG | GTTTTCTTAGTTAAAAAAATCTCAGGCTCTGATGCTAGGCAGCTTTATGCCATGAAG    c.300
 K   | V  F  L  V  K  K  I  S  G  S  D  A  R  Q  L  Y  A  M  K      p.100

          .         .      | 05  .         .         .         .    g.71522
 GTATTGAAGAAGGCCACACTGAAAG | TTCGAGACCGAGTTCGGACAAAAATGGAACGTGAT    c.360
 V  L  K  K  A  T  L  K  V |   R  D  R  V  R  T  K  M  E  R  D      p.120

          .         .         .         .       | 06 .         .    g.72378
 ATCTTGGTAGAGGTTAATCATCCTTTTATTGTCAAGTTGCATTATG | CTTTTCAAACTGAA    c.420
 I  L  V  E  V  N  H  P  F  I  V  K  L  H  Y  A |   F  Q  T  E      p.140

          .         .         .         .         .         .       g.72438
 GGGAAGTTGTATCTTATTTTGGATTTTCTCAGGGGAGGAGATTTGTTTACACGCTTATCC       c.480
 G  K  L  Y  L  I  L  D  F  L  R  G  G  D  L  F  T  R  L  S         p.160

        | 07 .         .         .         .         .         .    g.73093
 AAAGAG | GTGATGTTCACAGAAGAAGATGTCAAATTCTACTTGGCTGAACTTGCACTTGCT    c.540
 K  E   | V  M  F  T  E  E  D  V  K  F  Y  L  A  E  L  A  L  A      p.180

          .         .         .         .         .    | 08    .    g.78105
 TTAGACCATCTACATAGCCTGGGAATAATTTATAGAGACTTAAAACCAGAAAA | TATACTT    c.600
 L  D  H  L  H  S  L  G  I  I  Y  R  D  L  K  P  E  N  |  I  L      p.200

          .         .         .  | 09      .         .         .    g.78691
 CTTGATGAAGAAGGTCACATCAAGTTAACAG | ATTTCGGCCTAAGTAAAGAGTCTATTGAC    c.660
 L  D  E  E  G  H  I  K  L  T  D |   F  G  L  S  K  E  S  I  D      p.220

          .         .         .         .         .         .       g.78751
 CATGAAAAGAAGGCATATTCTTTTTGTGGAACTGTGGAGTATATGGCTCCAGAAGTAGTT       c.720
 H  E  K  K  A  Y  S  F  C  G  T  V  E  Y  M  A  P  E  V  V         p.240

          .         .         .         .         .     | 10   .    g.80272
 AATCGTCGAGGTCATACTCAGAGTGCTGACTGGTGGTCTTTTGGTGTGTTAATG | TTTGAA    c.780
 N  R  R  G  H  T  Q  S  A  D  W  W  S  F  G  V  L  M   | F  E      p.260

          .         .         .         .         .         .       g.80332
 ATGCTTACTGGTACACTCCCTTTCCAAGGAAAAGATCGAAAAGAAACAATGACTATGATT       c.840
 M  L  T  G  T  L  P  F  Q  G  K  D  R  K  E  T  M  T  M  I         p.280

       | 11  .         .         .         .         .         .    g.89603
 CTTAA | AGCCAAACTTGGAATGCCACAGTTTTTGAGTCCTGAAGCGCAGAGTCTTTTACGA    c.900
 L  K  |  A  K  L  G  M  P  Q  F  L  S  P  E  A  Q  S  L  L  R      p.300

          .         .         .     | 12   .         .         .    g.90160
 ATGCTTTTCAAGCGAAATCCTGCAAACAGATTAG | GTGCAGGACCAGATGGAGTTGAAGAA    c.960
 M  L  F  K  R  N  P  A  N  R  L  G |   A  G  P  D  G  V  E  E      p.320

          .         .         .          | 13        .         .    g.90301
 ATTAAAAGACATTCATTTTTCTCAACGATAGACTGGAAT | AAACTGTATAGAAGAGAAATT    c.1020
 I  K  R  H  S  F  F  S  T  I  D  W  N   | K  L  Y  R  R  E  I      p.340

          .         .         .         .         .         .       g.90361
 CATCCGCCATTTAAACCTGCAACGGGCAGGCCTGAAGATACATTCTATTTTGATCCTGAG       c.1080
 H  P  P  F  K  P  A  T  G  R  P  E  D  T  F  Y  F  D  P  E         p.360

          .         .   | 14     .         .         .         .    g.91382
 TTTACTGCAAAAACTCCCAAAG | ATTCACCTGGCATTCCACCTAGTGCTAATGCACATCAG    c.1140
 F  T  A  K  T  P  K  D |   S  P  G  I  P  P  S  A  N  A  H  Q      p.380

          .         .         .         .         .         .       g.91442
 CTTTTTCGGGGGTTTAGTTTTGTTGCTATTACCTCAGATGATGAAAGCCAAGCTATGCAG       c.1200
 L  F  R  G  F  S  F  V  A  I  T  S  D  D  E  S  Q  A  M  Q         p.400

          .         .        | 15.         .         .         .    g.93794
 ACAGTTGGTGTACATTCAATTGTTCAG | CAGTTACACAGGAACAGTATTCAGTTTACTGAT    c.1260
 T  V  G  V  H  S  I  V  Q   | Q  L  H  R  N  S  I  Q  F  T  D      p.420

          .         .         .         .         .         .       g.93854
 GGATATGAAGTAAAAGAAGATATTGGAGTTGGCTCCTACTCTGTTTGCAAGAGATGTATA       c.1320
 G  Y  E  V  K  E  D  I  G  V  G  S  Y  S  V  C  K  R  C  I         p.440

          .         .         .    | 16    .         .         .    g.97168
 CATAAAGCTACAAACATGGAGTTTGCAGTGAAG | ATTATTGATAAAAGCAAGAGAGACCCA    c.1380
 H  K  A  T  N  M  E  F  A  V  K   | I  I  D  K  S  K  R  D  P      p.460

          .         .         .         .         .         .       g.97228
 ACAGAAGAAATTGAAATTCTTCTTCGTTATGGACAGCATCCAAACATTATCACTCTAAAG       c.1440
 T  E  E  I  E  I  L  L  R  Y  G  Q  H  P  N  I  I  T  L  K         p.480

     | 17    .         .         .         .         .         .    g.98942
 GAT | GTATATGATGATGGAAAGTATGTGTATGTAGTAACAGAACTTATGAAAGGAGGTGAA    c.1500
 D   | V  Y  D  D  G  K  Y  V  Y  V  V  T  E  L  M  K  G  G  E      p.500

          .         .         .         .         .         .       g.99002
 TTGCTGGATAAAATTCTTAGACAAAAATTTTTCTCTGAACGAGAGGCCAGTGCTGTCCTG       c.1560
 L  L  D  K  I  L  R  Q  K  F  F  S  E  R  E  A  S  A  V  L         p.520

          .         .         .         .   | 18     .         .    g.101590
 TTCACTATAACTAAAACCGTTGAATATCTTCACGCACAAGGG | GTGGTTCATAGAGACTTG    c.1620
 F  T  I  T  K  T  V  E  Y  L  H  A  Q  G   | V  V  H  R  D  L      p.540

          .         .         .         .         .         .       g.101650
 AAACCTAGCAACATTCTTTATGTGGATGAATCTGGTAATCCGGAATCTATTCGAATTTGT       c.1680
 K  P  S  N  I  L  Y  V  D  E  S  G  N  P  E  S  I  R  I  C         p.560

          .         .         .         .         .         .       g.101710
 GATTTTGGCTTTGCAAAACAGCTGAGAGCGGAAAATGGTCTTCTCATGACTCCTTGTTAC       c.1740
 D  F  G  F  A  K  Q  L  R  A  E  N  G  L  L  M  T  P  C  Y         p.580

          .         .     | 19   .         .         .         .    g.103628
 ACTGCAAATTTTGTTGCACCAGAG | GTTTTAAAAAGACAAGGCTATGATGCTGCTTGTGAT    c.1800
 T  A  N  F  V  A  P  E   | V  L  K  R  Q  G  Y  D  A  A  C  D      p.600

          .         .         .         .  | 20      .         .    g.104890
 ATATGGAGTCTTGGTGTCCTACTCTATACAATGCTTACCGG | TTACACTCCATTTGCAAAT    c.1860
 I  W  S  L  G  V  L  L  Y  T  M  L  T  G  |  Y  T  P  F  A  N      p.620

          .         .         .         .         .         .       g.104950
 GGTCCTGATGATACACCAGAGGAAATATTGGCACGAATAGGTAGCGGAAAATTCTCACTC       c.1920
 G  P  D  D  T  P  E  E  I  L  A  R  I  G  S  G  K  F  S  L         p.640

          .         .         .          | 21        .         .    g.110404
 AGTGGTGGTTACTGGAATTCTGTTTCAGACACAGCAAAG | GACCTGGTGTCAAAGATGCTT    c.1980
 S  G  G  Y  W  N  S  V  S  D  T  A  K   | D  L  V  S  K  M  L      p.660

          .         .         .         .         .         .       g.110464
 CATGTAGACCCTCATCAGAGACTGACTGCTGCTCTTGTGCTCAGACATCCTTGGATCGTC       c.2040
 H  V  D  P  H  Q  R  L  T  A  A  L  V  L  R  H  P  W  I  V         p.680

          .         .         .         .         .         .       g.110524
 CACTGGGACCAACTGCCACAATACCAACTAAACAGACAGGATGCACCACATCTAGTAAAG       c.2100
 H  W  D  Q  L  P  Q  Y  Q  L  N  R  Q  D  A  P  H  L  V  K         p.700

  | 22       .         .         .         .         .         .    g.111172
  | GGTGCCATGGCAGCTACATATTCTGCTTTGAACCGTAATCAGTCACCAGTTTTGGAACCA    c.2160
  | G  A  M  A  A  T  Y  S  A  L  N  R  N  Q  S  P  V  L  E  P      p.720

          .         .         .         .         .         .       g.111232
 GTAGGCCGCTCTACTCTTGCTCAGCGGAGAGGTATTAAAAAAATCACCTCAACAGCCCTG       c.2220
 V  G  R  S  T  L  A  Q  R  R  G  I  K  K  I  T  S  T  A  L         p.740

                                                                    g.111235
 TGA                                                                c.2223
 X                                                                  p.740

          .         .         .         .         .         .       g.111295
 agtgacctcagtgagatatttggtaccatggtgtaagctgatagcacaagttctggcgac       c.*60

          .         .         .         .         .         .       g.111355
 aggtagcacgtatctgagagacacctgcaagcacacactgtcccagctggtacccataat       c.*120

          .         .         .         .         .         .       g.111415
 gctgctgttcctgctgctgctcctgctttcctctcttctcgctttaaatgattgttagca       c.*180

          .         .         .         .         .         .       g.111475
 agttagattttcctggagcttcggaagaaatgaaaatggaaacatgatgaagatatagtc       c.*240

          .         .         .         .         .         .       g.111535
 actgaatcaatgagaaaaataatgaacatatgaataccacctaaaaatacactgaataaa       c.*300

          .         .         .         .         .         .       g.111595
 gtacaccatatagcattatttttataggaaatatttcatgtcccttaaatattctttgtt       c.*360

          .         .         .         .         .         .       g.111655
 agttatagggatggacagtttatgttaagcacttagcttaaacaatccgtttatattagc       c.*420

          .         .         .         .         .         .       g.111715
 actgtatcccttgtgccatccaacattttgtatgtttttgtaaacagttcatatacagta       c.*480

          .         .         .         .         .         .       g.111775
 catttctgtactgctttctttaatgtatacatgccttgtttaacttggaatctattatta       c.*540

          .         .         .         .         .         .       g.111835
 ttaatcaattgactattaaatctggttaaatagttcacctggattaacagtattgttgga       c.*600

          .         .         .         .         .         .       g.111895
 cagtcctaaaaatggccagattgtggaacagctgttgaatgtaatacttccaaaatgtac       c.*660

          .         .         .         .         .         .       g.111955
 atatctttccccacgtctgtttcactggttcgttcatttgtttgtttcttaaagtcaggt       c.*720

          .         .         .         .         .         .       g.112015
 gctctgtcagactaacctagagagctgttatggtagagaaagttatcatatgtgtgtggc       c.*780

          .         .         .         .         .         .       g.112075
 atgaaatcaagaatacacctatgaagttagtccatatactttgcaactccttagagtact       c.*840

          .         .         .         .         .         .       g.112135
 tttttccttaattaaggaagtagtccttgcacttctaatcttacatagcatccatactta       c.*900

          .         .         .         .         .         .       g.112195
 gaatttggcatatcatctgggattttgccaatatacgtcaaagccctttaagagtcatgg       c.*960

          .         .         .         .         .         .       g.112255
 taaggagatgggtgaaggaaaatttagcaacaggtaattgaagtcctattggatatttca       c.*1020

          .         .         .         .         .         .       g.112315
 tgtttaaatagatattctatattaaacactaatttaaatgtaataaaggccaaaggcctc       c.*1080

          .         .         .         .         .         .       g.112375
 tgtatgaaattggatttaaactttcttattttagggaataaaacattattgatcaaacag       c.*1140

          .         .         .         .         .         .       g.112435
 tatctgttctaacctaaaattataggtagggcaggctaagtgaacagcattgagtatttt       c.*1200

          .         .         .         .         .         .       g.112495
 ctgaatccctcatgataatttatagccacatactgcttcctttgacttcaggaatgatca       c.*1260

          .         .         .         .         .         .       g.112555
 gttttcataatggccactgggcctgcttagattgcagtattcattatctgcatctaattt       c.*1320

          .         .         .         .         .         .       g.112615
 ggtagtttccacaatcgtatttgatgaaagaaacttcagtccccattattacctgtgtct       c.*1380

          .         .         .         .         .         .       g.112675
 ttgccaagctgcctagcatacatcagtatgtaatgtaaaagacatatgagcaagaaaaaa       c.*1440

          .         .         .         .         .         .       g.112735
 gtgatttaacttacctcatcaagaatgtgcccctacaggccgggcgcagtggctcacgcc       c.*1500

          .         .         .         .         .         .       g.112795
 tgtaatcccagcattttgggaggccgaggcaggtggatcacctgaggtcaggagtttgag       c.*1560

          .         .         .         .         .         .       g.112855
 accagcctggccaacatggtgaaaccccgtctctactaaaaaatacaaaaattagctggg       c.*1620

          .         .         .         .         .         .       g.112915
 catggtggcgtgcacctgtaatcctagctactcaggaggctgaggcaggagaatcgcttg       c.*1680

          .         .         .         .         .         .       g.112975
 aacctgggaggtggtggttgcagtgagccaagatcacaccattgcactccagcctgggtg       c.*1740

          .         .         .         .         .         .       g.113035
 acagagtgagactctgtctcaagaaggaaaaaaaaaaaaaagaatgtactcatacagatt       c.*1800

          .         .         .         .         .         .       g.113095
 tttgttagtcatcatgtaataagccatttatatcagaaaccttttttcctgccacagaag       c.*1860

          .         .         .         .         .         .       g.113155
 ctttaaattttcccctaagagtacaaagccaagagagtgtggtttatctaaatgtcctga       c.*1920

          .         .         .         .         .         .       g.113215
 aatccacttgtcattccttaatttctcctctatgcaattaaagagaaaggggaaatctat       c.*1980

          .         .         .         .         .         .       g.113275
 aacatttcttttgcccaagtgacacaaaaatgattactgcatagaaatcaaatgtaagtt       c.*2040

          .         .         .         .         .         .       g.113335
 tagcttctaaatgaaataatatataggagggatatcagaatgtctagatagagaaagtat       c.*2100

          .         .         .         .         .         .       g.113395
 tttcaaattcttgaatatatggatgctattaaaagctgctttccattgcctggaaagaga       c.*2160

          .         .         .         .         .         .       g.113455
 gcttttttccctcctctattcagtgtttcaaactttggtcatctcaaattattgtcactt       c.*2220

          .         .         .         .         .         .       g.113515
 ttaaaatgttaatgtcattctgagcagaaatagatatattttcagatttttttacactga       c.*2280

          .         .         .         .         .         .       g.113575
 tgctactccgtaattgcttaggagtattgtccatcatagtattttagaactagaagtaaa       c.*2340

          .         .         .         .         .         .       g.113635
 cacataaatccttataaattacccaatccaactttctcatattgcatgtagagaacctga       c.*2400

          .         .         .         .         .         .       g.113695
 gacacatatcaaagtctagaatccttaacttctccccattttgtttttttccgcctcatc       c.*2460

          .         .         .         .         .         .       g.113755
 acaccatgctgcctttccctcatatgatcaccaaccagtagctgagttcaaaaactacat       c.*2520

          .         .         .         .         .         .       g.113815
 atttcttgggcagtcctctactggtatgtgatgccaacttttatttctttcgaagataat       c.*2580

          .         .         .         .         .         .       g.113875
 tgccttctttgcctagccaagcagccaattttattggagaaaagcaagttatatgttcac       c.*2640

          .         .         .         .         .         .       g.113935
 aaaatggaaggctttctacctaaatttatttcatctgtggtcctcttattctcttccatt       c.*2700

          .         .         .         .         .         .       g.113995
 gcttttgacatacagtggaaaaacttggccaacgatgtgctctaaatatagtgcttgtgt       c.*2760

          .         .         .         .         .         .       g.114055
 tgggttaacttttccattaatttctcaacatcaattattcaggcccctacagttgtggta       c.*2820

          .         .         .         .         .         .       g.114115
 ttgaggcccctaaaggcttctgcctttcaccaattagtgctgccagttactgaggcttct       c.*2880

          .         .         .         .         .         .       g.114175
 cccaaaaggtatcagtccagtcttaaagatatttcattgtgaaagaagaaactaaactat       c.*2940

          .         .         .         .         .         .       g.114235
 caggcctcttttacaaaatgagagattgaatttaagcttgtcaagcacgtactggaaggt       c.*3000

          .         .         .         .         .         .       g.114295
 atgaattacactaccatgtgttttgtatcttccctttcaagtgatgatgttaaatgaagg       c.*3060

          .         .         .         .         .         .       g.114355
 taagtttttcatccttttttaatttttgttttttataaatcatttcagctttttctggtt       c.*3120

          .         .         .         .         .         .       g.114415
 tatagaggtgtcttatttctaatgcaacagacccccaactttaacagatttgatatggat       c.*3180

          .         .         .         .         .         .       g.114475
 gcatttattcacaagcaaccccaaaagtccaaaaatgtaataattttgacaaggcccaaa       c.*3240

          .         .         .         .         .         .       g.114535
 gttgagatgctatgaagcttgtgtgtgtgaaaagtcagttatgattgtctggagagaagc       c.*3300

          .         .         .         .         .         .       g.114595
 tgtggtgtgtatgctgtagagtttccacatttcacatgcagtgtactccaaaaagcgggt       c.*3360

          .         .         .         .         .         .       g.114655
 ttgggtcaaccatttcccatctctttttaagaagtgactgctgttggggccaggggacat       c.*3420

          .         .         .         .         .         .       g.114715
 catgggaggtggggctgtccagttagctgtgccctgcaccttcagcccaggaaagatttg       c.*3480

          .         .         .         .         .         .       g.114775
 aacagagcaaaggcttcaagagagggcagaatgtattcggcagaaaagggactcaggtaa       c.*3540

          .         .         .         .         .         .       g.114835
 gcccagcctgggatgagagcagaaaagcattcaagatttgcaggccttgctatggatgcg       c.*3600

          .         .         .         .         .         .       g.114895
 cttaatcaccatggaggccagcaatacccatctcagcatggctttgatattctctacttc       c.*3660

          .         .         .         .         .         .       g.114955
 ctggcctttaaaaatgacctataatttttcagtttgctttactatattttataaagaaaa       c.*3720

          .         .         .         .         .         .       g.115015
 ttctatcttatggttgattgagcattgagacttatgaaggcattaggatagatagctcag       c.*3780

          .         .         .         .         .         .       g.115075
 gaatgtaaaggttcagaaaaggtctgttttctcagattaacaaatatgatggattccatg       c.*3840

          .         .         .         .         .         .       g.115135
 gctgaccttggtgcttaaaccaggaggtttcaatctagtcctagagttgtgtccctctga       c.*3900

          .         .         .         .         .         .       g.115195
 aaggcccaatgccatgtaactaactttaaactggatatatactttgagccttacttaatt       c.*3960

          .         .         .         .         .         .       g.115255
 cacagataagttgacttaactcagtatttttatttcaattaatgaaaacagtcctctttt       c.*4020

          .         .         .         .         .         .       g.115315
 caaccccaggttgcttacattttgctggtctccccaagtgaccattggtggagaccaatt       c.*4080

          .         .         .         .         .         .       g.115375
 aatgaaggaatgaaattcactttattgggactgtggtattcaacagagccacacttaacc       c.*4140

          .         .         .         .         .         .       g.115435
 actttttccaatgaagaatctccagaatgataatgcccaaatatggatggccaagaagaa       c.*4200

          .         .         .         .         .         .       g.115495
 tttgtatctacggtgtgctttatgtgtttttgacactgctgtattctgtgtgatcaagtg       c.*4260

          .         .         .         .         .         .       g.115555
 atttgcagctggttccaatgtgactgagtgttctcaaagatttctagtaactaagtcaac       c.*4320

          .         .         .         .         .         .       g.115615
 ttaattttcttaagcctggtattactatcagcctcacatttaccactttgattctagttt       c.*4380

          .         .         .         .         .         .       g.115675
 tttaactgttcataacagggcataccgagggttgggatgagagcctacttcctacctctt       c.*4440

          .         .         .         .         .         .       g.115735
 aaggcactttcctcattattttgccatataatcttgaactgcatgataagctgtttaaat       c.*4500

          .         .         .         .         .         .       g.115795
 gtccatgacttctcccagagcaactagcaaagtatatgacattttgaatagagattagtg       c.*4560

          .         .         .         .         .         .       g.115855
 gaaaggaaaatgtagagatttaagttcagaggtacaaacctcaataaaacctccttagag       c.*4620

          .         .         .         .         .         .       g.115915
 cacataccatgagtagagtatatgtaaacgtatatgagaagagagtcgctataatagtcc       c.*4680

          .         .         .         .         .         .       g.115975
 tctctaagtagattagttcattgtctaatggaagtgaacatctttactcctgttatcacc       c.*4740

          .         .         .         .         .         .       g.116035
 atagtactgaatgaactgtataatgagtttttcaaacaagtatttaaaatagaactttca       c.*4800

          .         .         .         .         .         .       g.116095
 cgtacaaagcaagggcataaagattttggtttgtgtttctgtaagtgtagtttaccatct       c.*4860

          .         .         .         .         .         .       g.116155
 aaagctttggtttttaattttaaaaaaagcttcaaggtattgccattccttagcatcctt       c.*4920

          .         .         .         .         .         .       g.116215
 attgattatgggtgatgagtttttaactcttaaaatcatatacgtgtattagtttatctt       c.*4980

          .         .         .         .         .         .       g.116275
 aactgttgccctaagcaaaagggaaggtatacacctaagggatgtacttattttgcattt       c.*5040

          .         .         .         .         .         .       g.116335
 ttggtcatgggtgggaatggggtgggtgcctacttaaatagtttttaaaaaagaaaaaaa       c.*5100

          .         .         .         .         .         .       g.116395
 tcacaaatatttttctactgttatatatgatcttcctttatactagtttctctctagtaa       c.*5160

          .         .         .         .         .         .       g.116455
 ggcatgccagaagcccaagataccatatcatgaattcttacatattgtaccttttgttgg       c.*5220

          .         .         .         .         .         .       g.116515
 tggttaaatcgcatcagatgcttggcattgctgccataattataaaatgcttgtaaagga       c.*5280

          .         .         .         .         .         .       g.116575
 tcaaatatcactaaatactttaaattgttttacttaagagtctaatctgggaagttttca       c.*5340

          .         .         .         .         .         .       g.116635
 aatcatactattaatgtgtaatctaagctcttcagatgtatccatgaataatcctggaac       c.*5400

          .         .         .         .         .         .       g.116695
 aatattgcttgtattcctgtcatagaacaggttttgtaatctttaaaagaaatgaaaatt       c.*5460

          .         .                                               g.116722
 tatataataaagtttcaaatcaatgca                                        c.*5487

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Ribosomal protein S6 kinase, 90kDa, polypeptide 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 20c
©2004-2018 Leiden University Medical Center