retinoschisin 1 (RS1) - coding DNA reference sequence

(used for variant description)

(last modified July 23, 2019)

This file was created to facilitate the description of sequence variants on transcript NM_000330.3 in the RS1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008659.3, covering RS1 transcript NM_000330.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5035
                          agtaaggtagagctttggccgaggacgaggggaag       c.-1

          .         .         .         .         .   | 02     .    g.19446
 ATGTCACGCAAGATAGAAGGCTTTTTGTTATTACTTCTCTTTGGCTATGAAG | CCACATTG    c.60
 M  S  R  K  I  E  G  F  L  L  L  L  L  F  G  Y  E  A |   T  L      p.20

          .         | 03         .         .         .         .    g.20387
 GGATTATCGTCTACCGAG | GATGAAGGCGAGGACCCCTGGTACCAAAAAGCATGCAAGTGC    c.120
 G  L  S  S  T  E   | D  E  G  E  D  P  W  Y  Q  K  A  C  K  C      p.40

          .         .         .         .         .         .       g.20447
 GATTGCCAAGGAGGACCCAATGCTCTGTGGTCTGCAGGTGCCACCTCCTTGGACTGTATA       c.180
 D  C  Q  G  G  P  N  A  L  W  S  A  G  A  T  S  L  D  C  I         p.60

      | 04   .         .         .         .         .         .    g.29827
 CCAG | AATGCCCATATCACAAGCCTCTGGGTTTCGAGTCAGGGGAGGTCACACCGGACCAG    c.240
 P  E |   C  P  Y  H  K  P  L  G  F  E  S  G  E  V  T  P  D  Q      p.80

          .         .         .         .         .         .       g.29887
 ATCACCTGCTCTAACCCGGAGCAGTATGTGGGCTGGTATTCTTCGTGGACTGCAAACAAG       c.300
 I  T  C  S  N  P  E  Q  Y  V  G  W  Y  S  S  W  T  A  N  K         p.100

          .         .       | 05 .         .         .         .    g.32512
 GCCCGGCTCAACAGTCAAGGCTTTGG | GTGTGCCTGGCTCTCCAAGTTCCAGGACAGTAGC    c.360
 A  R  L  N  S  Q  G  F  G  |  C  A  W  L  S  K  F  Q  D  S  S      p.120

          .         .         .         .         .         .       g.32572
 CAGTGGTTACAGATAGATCTGAAGGAGATCAAAGTGATTTCAGGGATCCTCACCCAGGGG       c.420
 Q  W  L  Q  I  D  L  K  E  I  K  V  I  S  G  I  L  T  Q  G         p.140

          .         .         .         .         .         .       g.32632
 CGCTGTGACATCGATGAGTGGATGACCAAGTACAGCGTGCAGTACAGGACCGATGAGCGC       c.480
 R  C  D  I  D  E  W  M  T  K  Y  S  V  Q  Y  R  T  D  E  R         p.160

          .         .         .         .   | 06     .         .    g.34965
 CTGAACTGGATTTACTACAAGGACCAGACTGGAAACAACCGG | GTCTTCTATGGCAACTCG    c.540
 L  N  W  I  Y  Y  K  D  Q  T  G  N  N  R   | V  F  Y  G  N  S      p.180

          .         .         .         .         .         .       g.35025
 GACCGCACCTCCACGGTTCAGAACCTGCTGCGGCCCCCCATCATCTCCCGCTTCATCCGC       c.600
 D  R  T  S  T  V  Q  N  L  L  R  P  P  I  I  S  R  F  I  R         p.200

          .         .         .         .         .         .       g.35085
 CTCATCCCGCTGGGCTGGCACGTCCGCATTGCCATCCGGATGGAGCTGCTGGAGTGCGTC       c.660
 L  I  P  L  G  W  H  V  R  I  A  I  R  M  E  L  L  E  C  V         p.220

          .                                                         g.35100
 AGCAAGTGTGCCTGA                                                    c.675
 S  K  C  A  X                                                      p.224

          .         .         .         .         .         .       g.35160
 tgcctgcctcagctcggcgcctgccagggggtgactggcacagagcgggccgtaggggac       c.*60

          .         .         .         .         .         .       g.35220
 cccctcacacaccaccgagatggacagggctatatttcgcaaagcaattgtaactgcagt       c.*120

          .         .         .         .         .         .       g.35280
 gctgggtagataatttttttttttttaagatatagctttctgatttcaatgaaataaaaa       c.*180

          .         .         .         .         .         .       g.35340
 tgaacttattccccactcagggccagagaaagtcagaacaaagaaaatgtccccgaaacg       c.*240

          .         .         .         .         .         .       g.35400
 aattttcttacaaaagcctaagtagcaggggtaattttctgctcattttttgtctcagtg       c.*300

          .         .         .         .         .         .       g.35460
 atactgtgaaaggtgcagtctcaggggaacacaaagcagccctgataatttgaaaattca       c.*360

          .         .         .         .         .         .       g.35520
 tttgctttaccacattcaagacagaaacatacagtttcctaaagcctggctttgaatgca       c.*420

          .         .         .         .         .         .       g.35580
 gaagggagcagctcctcctagttaagtttccactaaatcatcgccaaagaggacttcaga       c.*480

          .         .         .         .         .         .       g.35640
 gccctggggaggcagctgagggtctcaagggtgactgggtggcagggatgagtgcggtgg       c.*540

          .         .         .         .         .         .       g.35700
 gtgagaatcccggtgccctgagaggctatacgtgacaaatgaccaaaagcccaaggtagg       c.*600

          .         .         .         .         .         .       g.35760
 ggagtttcctctgctcacagttcttaccttcaaggcggatctgggcttccaccctcatga       c.*660

          .         .         .         .         .         .       g.35820
 acacagggattggggagggaccagagcgcccaatacacacagctccattatgcaatccat       c.*720

          .         .         .         .         .         .       g.35880
 tccagcaaattccccgtgtctgtggtcaccatttaggtgatcatacaggacaggctgcac       c.*780

          .         .         .         .         .         .       g.35940
 atctcagtatatgtagggaccccaaatgaccacaacacagtacaattgccctttacctag       c.*840

          .         .         .         .         .         .       g.36000
 ggctaccatttcctagcaaaccaaacatagttcgagaacagctggcccaggagctaccac       c.*900

          .         .         .         .         .         .       g.36060
 tggctactcagaggaggctcattagctggctacatgcttcgcaggaagtgggaaggactc       c.*960

          .         .         .         .         .         .       g.36120
 acatcataaaaaggaccatgtagctttttccctgaaagcttctcaccctccaccctctgc       c.*1020

          .         .         .         .         .         .       g.36180
 cttgcaatacgcaaactgcgcctgctcctgaaaagctctctgggaaggaatgggcctggc       c.*1080

          .         .         .         .         .         .       g.36240
 tttccgttcctggaggcggcgccttagattgggaggcctcattggccacttagagcgcag       c.*1140

          .         .         .         .         .         .       g.36300
 cctgagtttccaggccccttcctgggagaggctgttaacacgggggaggggcaggagagg       c.*1200

          .         .         .         .         .         .       g.36360
 gatatggagagcaggtggtggaatcagaggacgaggctgctctaaagactgttctggccc       c.*1260

          .         .         .         .         .         .       g.36420
 cagacacagggtagtctttgctagcagctcatttccgagttacttttcattttcaaatgc       c.*1320

          .         .         .         .         .         .       g.36480
 caaggcaagtgactagactcgcgctaatacagtgctggacaacacattcaccttttctgt       c.*1380

          .         .         .         .         .         .       g.36540
 gaacaggcagccttctaaaagccccaaacatccttcttgatgctttgggggctcaattat       c.*1440

          .         .         .         .         .         .       g.36600
 tttatatccaacccagcatctttctagtccctatgctgtatgcttgaacttcggaaaatg       c.*1500

          .         .         .         .         .         .       g.36660
 cttttccccgcccaatcttctctcaaatataaacacatcacacagggtgttgggggtggg       c.*1560

          .         .         .         .         .         .       g.36720
 gggggggggtggggggacttatccctggccttaggacacaggacaaatctattttggata       c.*1620

          .         .         .         .         .         .       g.36780
 gaaatgcctgaacagagacccttatttggaaaggtgaattaactttggtcacgacatgga       c.*1680

          .         .         .         .         .         .       g.36840
 ctgtcagacaaaatggcagtatcctaagagttaaggcacatcaaacacaggagtcgagag       c.*1740

          .         .         .         .         .         .       g.36900
 agtgcagttcagggaaaaaggagaggaggaaacagtgaggcagggagaaaggctttccaa       c.*1800

          .         .         .         .         .         .       g.36960
 ataagagttcatgttggaaacttttgtcacggctttattgagattaagttcacatacaat       c.*1860

          .         .         .         .         .         .       g.37020
 ttgtatccatttaaagtgtacaatttgatgacttttggtatattcagagttgtgcaacca       c.*1920

          .         .         .         .         .         .       g.37080
 ttatcactagatcaattttagaaagtttatcaccccaaagagaaatcctgcacccatcag       c.*1980

          .         .         .         .         .         .       g.37140
 ccaacactccccaacccatcggccaccccaagccctctgcaaccacgaatcgactgtctc       c.*2040

          .         .         .         .         .         .       g.37200
 tgtagattggccttctggacgttctacataaatgaaatcatatagtatgtggtatttcgt       c.*2100

          .         .         .         .         .         .       g.37260
 gactggcttctttcacttagcatagtgttttaaagttcatccacgttataacatgtgtat       c.*2160

          .         .         .         .         .         .       g.37320
 cactatgtcacttgtcactcctttttattgctgaacatcattgttcagtatcatgtcaag       c.*2220

          .         .         .         .         .         .       g.37380
 agcacattgttatttatccattcatccattgatggatatttgggtttccactctttagct       c.*2280

          .         .         .                                     g.37416
 attatgaataatgctgctatgaacatttgtgtataa                               c.*2316

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Retinoschisin 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.