regulator of telomere elongation helicase 1 (RTEL1) - 363 nt intron 26 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.37692
gtgcggacgggcagcgctgggtgggcggtgtgggggtggcggagcgggcggcgtggggcg  c.2413+60

         .         .         .         .         .         .  g.37752
ggcagcaccaggcgcccagggcggaggcgactcacctggctttgtgcgcttcccctccca  c.2413+120

         .         .         .         .         .         .  g.37812
cctccaaaggctgcctctccctcctagggcagggcccccacgggctgcaaccctccccta  c.2413+180

    g.37814
ca  c.2413+182

--------------------- middle of intron ---------------------
                                               g.37815        g.37815
                                               c.2414-181  g  c.2414-181

.         .         .         .         .         .           g.37875
gcagagaacgccccaggcaaggatgccccccgaggctgagactccccccaatagcaggga  c.2414-121

.         .         .         .         .         .           g.37935
ggacacccacaggcaggaccccaagtgctgggactctcccccaagaggggctttgccaca  c.2414-61

.         .         .         .         .         .           g.37995
ggcagggaccccagctggggccccccgtgggcttcactgcgcactcgggtgcccctgcag  c.2414-1


Powered by LOVD v.3.0 Build 14
©2004-2015 Leiden University Medical Center