regulator of telomere elongation helicase 1 (RTEL1) - 794 nt intron 27 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.38198
gtacagttccagggccttgggatggacacagaccctctgtctcctgaggccaacccgacc  c.2556+60

         .         .         .         .         .         .  g.38258
ccgcccatctggcctcaggcacctccccacacacccctgtaaatcccctgcctggcaggc  c.2556+120

         .         .         .         .         .         .  g.38318
aggcgggcaagcgggcgggggatcccagctgcctggctgtctgtgggtcctccaccccac  c.2556+180

         .         .         .         .         .         .  g.38378
ctcacccacaggctgctggctcccaggtggtgcatgccctggccctccgcgggtgccccc  c.2556+240

         .         .         .         .         .         .  g.38438
cacatcactttggttctctggcgggtcagcttggctcagtgcactcaaggtcgggtgccc  c.2556+300

         .         .         .         .         .         .  g.38498
ctgccactggctgcgcttgaggctggcctttctccaggaatgtgctgcgggtggaaccca  c.2556+360

         .         .         .         g.38535
ggttccttcttccttggggccttttgccccagaagcc  c.2556+397

--------------------- middle of intron ---------------------
           g.38536            .         .         .           g.38572
           c.2557-397  cataattcctcaggccaacccgaaattttctccctgc  c.2557-361

.         .         .         .         .         .           g.38632
ttcctgctgggagccattcccctcttcctgcccatccctgcccttcaggcccctggagtg  c.2557-301

.         .         .         .         .         .           g.38692
agctccaggtgcaggcaccaggcacctgtgtccccttcctgccagcccctcgctgtggtc  c.2557-241

.         .         .         .         .         .           g.38752
ggactgtcttccctggacctgctcttacaagtcaccacctgcgagcctcatgagccgctg  c.2557-181

.         .         .         .         .         .           g.38812
gtgtgacttggacaggaccaagttgtggcactgtcaccggggtgtgctgtgcccccctcc  c.2557-121

.         .         .         .         .         .           g.38872
cccgacctccatcttggctcagggctccttgggaccatcttccctgtgcgtccaggtgct  c.2557-61

.         .         .         .         .         .           g.38932
ttgggaccccagagtgtgtggttggggtctgtgtgtggttgtgagctgtgtcctcctcag  c.2557-1


Powered by LOVD v.3.0 Build 14
©2004-2015 Leiden University Medical Center