regulator of telomere elongation helicase 1 (RTEL1) - 967 nt intron 28 reference sequence

(intronic numbering for coding DNA Reference Sequence)
         .         .         .         .         .         .  g.39088
gtgcgtgagctgtccctgcacctgtgccgaccaccatagacacgcatgggaacgcagccg  c.2652+60

         .         .         .         .         .         .  g.39148
tgggtgcccccagccacggctggtcccgatgggaccagggaatccacccccaggagctga  c.2652+120

         .         .         .         .         .         .  g.39208
tgtccagggcagctgtgatgctgacggccaggggctcaagtgtgtggtttcttctgcagg  c.2652+180

         .         .         .         .         .         .  g.39268
gggctcatgagtcccagctggaatcaggccccacccttgggcaggtttggcatggggcct  c.2652+240

         .         .         .         .         .         .  g.39328
gcagcactgggcttggccctggcatttccctcaagtgtggatgcacacctgcctcatgtg  c.2652+300

         .         .         .         .         .         .  g.39388
agggacacagcccattcctagccttggatcaaagaacggagttatagccggagccaggaa  c.2652+360

         .         .         .         .         .         .  g.39448
gccccctgcctgctggaaaaccccaagtgtggcggcctttgtccatgtcccttggcttct  c.2652+420

         .         .         .         .         .         .  g.39508
gggaagaactgggtggtgcccaggcagggctggtgccatcaggaagtgggtggctgctga  c.2652+480

      g.39512
gggg  c.2652+484

--------------------- middle of intron ---------------------
                                             g.39513          g.39515
                                             c.2653-483  cct  c.2653-481

.         .         .         .         .         .           g.39575
gggctggcgagggcctgggtggggagtgcctgggccgcccctgccttggtttccacgttt  c.2653-421

.         .         .         .         .         .           g.39635
ccgtgttggtctggggtgtgtagagagatgggcactgctcatccggaagcccctccttgt  c.2653-361

.         .         .         .         .         .           g.39695
gcgctgccatcctgggagcctcagccgcatccgctgtggggcagggggcttgagggagga  c.2653-301

.         .         .         .         .         .           g.39755
ggagagagacgggccatgcaggacccctggcttgaggcagagccaatctaccctttgccc  c.2653-241

.         .         .         .         .         .           g.39815
attcactgctctcagttccctgccagcctctcactgtgtgacctcagacgggcccagccc  c.2653-181

.         .         .         .         .         .           g.39875
cacagctttcttcccgcagcccctccctatgtccatccagccagccagtttctcaggcag  c.2653-121

.         .         .         .         .         .           g.39935
cagccccacctcggcagtcactgtcccagggaacgctcaatgttccaaggaaggctctgc  c.2653-61

.         .         .         .         .         .           g.39995
agccccagggaccagatgatgaggctggccctgatggagcctcgggcctgtgtcctgcag  c.2653-1