regulator of telomere elongation helicase 1 (RTEL1) - 252 nt intron 31 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.41739
gtagctgactcctgaaccgtgtgcagcctacgacttggtgggtccctcagtggcttcacg  c.3109+60

         .         .         .         .         .         .  g.41799
aggctaactcttgagtgtggccggggctgcccctgtggggagccatctcatggtggggac  c.3109+120

        g.41805
tgctcc  c.3109+126

--------------------- middle of intron ---------------------
                                          g.41806             g.41811
                                          c.3110-126  cggttc  c.3110-121

.         .         .         .         .         .           g.41871
tgcaccccgcagttgtcctgagcagctctccaggagttcctggaggaagggcgggcaggg  c.3110-61

.         .         .         .         .         .           g.41931
cggtgggactctcagtcctccaccccagcgccactctgagccatgctactcccacaccag  c.3110-1


Powered by LOVD v.3.0 Build 14
©2004-2015 Leiden University Medical Center