regulator of telomere elongation helicase 1 (RTEL1) - 297 nt intron 34 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.42731
gtgagcctcatgggagagacatcgctgggcagcaggccacgggagctccgggcgggcccc  c.3652+60

         .         .         .         .         .         .  g.42791
tctcagcaggctgtgtgtgccagggctgtggggcagaggacgtggtgcccttccagtgcc  c.3652+120

         .         .           g.42820
ctgcctgtgacttccagcgctgccaagcc  c.3652+149

--------------------- middle of intron ---------------------
                    g.42821             .         .           g.42848
                    c.3653-148  tgctggcaacggcaccttcaggttggtg  c.3653-121

.         .         .         .         .         .           g.42908
cctggccactacagttcctgctgggtgtagccccaggtgatgggctgagggggaaagggc  c.3653-61

.         .         .         .         .         .           g.42968
aggcccttgtcctggtggcaacgcctggcagacgtgtgcagtgggccggttgtctcacag  c.3653-1


Powered by LOVD v.3.0 Build 14
©2004-2015 Leiden University Medical Center