ryanodine receptor 1 (skeletal) (RYR1) - coding DNA reference sequence

(used for variant description)

(last modified December 30, 2019)


This file was created to facilitate the description of sequence variants in the RYR1 gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_008866.1, covering RYR1 transcript variant-1 (NM_000540.2). Transcript variant-2 skips exon 70 (NM_001042723.1).

Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5010
                                                   tctacctcgc       c.-121

 .         .         .         .         .         .                g.5070
 gggtgcctctggtgtctccagaggtctccgaccccagcccgcccccagccctcccgccca       c.-61

 .         .         .         .         .         .                g.5130
 gcccgcagccccctccctctgttccccgacctcagaccctgggcttccgacctcgacatc       c.-1

          .         .         .         .      | 02  .         .    g.12060
 ATGGGTGACGCAGAAGGCGAAGACGAGGTCCAGTTCCTGCGGACG | GACGATGAGGTGGTC    c.60
 M  G  D  A  E  G  E  D  E  V  Q  F  L  R  T   | D  D  E  V  V      p.20

          .         .         .         .         .         .       g.12120
 CTGCAGTGCAGCGCTACCGTGCTCAAGGAGCAGCTCAAGCTCTGCCTGGCCGCCGAGGGC       c.120
 L  Q  C  S  A  T  V  L  K  E  Q  L  K  L  C  L  A  A  E  G         p.40

          .         .         .         .      | 03  .         .    g.13664
 TTCGGCAACCGCCTGTGCTTCCTGGAGCCCACTAGCAACGCGCAG | AATGTGCCCCCCGAT    c.180
 F  G  N  R  L  C  F  L  E  P  T  S  N  A  Q   | N  V  P  P  D      p.60

          .         .         .         .         .         .       g.13724
 CTGGCCATCTGTTGCTTCGTCCTGGAGCAGTCCCTGTCTGTGCGAGCCCTGCAGGAGATG       c.240
 L  A  I  C  C  F  V  L  E  Q  S  L  S  V  R  A  L  Q  E  M         p.80

          .         .         . | 04       .         .         .    g.14888
 CTGGCTAACACGGTGGAGGCTGGCGTGGAG | TCATCCCAGGGCGGGGGACACAGGACGCTC    c.300
 L  A  N  T  V  E  A  G  V  E   | S  S  Q  G  G  G  H  R  T  L      p.100

          .         .         .         .      | 05  .         .    g.15033
 CTGTATGGCCATGCCATCCTGCTCCGGCATGCACACAGCCGCATG | TATCTGAGCTGCCTC    c.360
 L  Y  G  H  A  I  L  L  R  H  A  H  S  R  M   | Y  L  S  C  L      p.120

          .         .         .         .         .         .       g.15093
 ACCACCTCCCGCTCCATGACTGACAAGCTGGCCTTCGATGTGGGACTGCAGGAGGACGCA       c.420
 T  T  S  R  S  M  T  D  K  L  A  F  D  V  G  L  Q  E  D  A         p.140

      | 06   .         .         .         .         .         .    g.15505
 ACAG | GAGAGGCTTGCTGGTGGACCATGCACCCAGCCTCCAAGCAGAGGTCTGAAGGAGAA    c.480
 T  G |   E  A  C  W  W  T  M  H  P  A  S  K  Q  R  S  E  G  E      p.160

          .         .         .         .         .        | 07.    g.15887
 AAGGTCCGCGTTGGGGATGACATCATCCTTGTCAGTGTCTCCTCCGAGCGCTACCTG | CAC    c.540
 K  V  R  V  G  D  D  I  I  L  V  S  V  S  S  E  R  Y  L   | H      p.180

          .         .         .         .         .         .       g.15947
 CTGTCGACCGCCAGTGGGGAGCTCCAGGTTGACGCTTCCTTCATGCAGACACTATGGAAC       c.600
 L  S  T  A  S  G  E  L  Q  V  D  A  S  F  M  Q  T  L  W  N         p.200

          .         .         .  | 08      .         .         .    g.17801
 ATGAACCCCATCTGCTCCCGCTGCGAAGAGG | GCTTCGTGACGGGAGGTCACGTCCTCCGC    c.660
 M  N  P  I  C  S  R  C  E  E  G |   F  V  T  G  G  H  V  L  R      p.220

          .         .         .         .         .         .       g.17861
 CTCTTTCATGGACATATGGATGAGTGTCTGACCATTTCCCCTGCTGACAGTGATGACCAG       c.720
 L  F  H  G  H  M  D  E  C  L  T  I  S  P  A  D  S  D  D  Q         p.240

       | 09  .         .         .         .         .         .    g.18049
 CGCAG | ACTTGTCTACTATGAGGGGGGAGCTGTGTGCACTCATGCCCGCTCCCTCTGGAGG    c.780
 R  R  |  L  V  Y  Y  E  G  G  A  V  C  T  H  A  R  S  L  W  R      p.260

          .         . | 10       .         .         .         .    g.19695
 CTGGAGCCACTGAGAATCAG | CTGGAGTGGGAGCCACCTGCGCTGGGGCCAGCCACTCCGA    c.840
 L  E  P  L  R  I  S  |  W  S  G  S  H  L  R  W  G  Q  P  L  R      p.280

          .         .         .         .         .         .       g.19755
 GTCCGGCATGTCACTACCGGGCAGTACCTAGCGCTCACCGAGGACCAGGGCCTGGTGGTG       c.900
 V  R  H  V  T  T  G  Q  Y  L  A  L  T  E  D  Q  G  L  V  V         p.300

          .         .         .         .         .        | 11.    g.19952
 GTTGACGCCAGCAAGGCTCACACCAAGGCTACCTCCTTCTGCTTCCGCATCTCCAAG | GAG    c.960
 V  D  A  S  K  A  H  T  K  A  T  S  F  C  F  R  I  S  K   | E      p.320

          .         .         .         .         .         .       g.20012
 AAGCTGGATGTGGCCCCCAAGCGGGATGTGGAGGGCATGGGCCCCCCTGAGATCAAGTAC       c.1020
 K  L  D  V  A  P  K  R  D  V  E  G  M  G  P  P  E  I  K  Y         p.340

          .         .         .         .         .         .       g.20072
 GGGGAGTCACTGTGCTTCGTGCAGCATGTGGCCTCAGGACTGTGGCTCACCTATGCTGCT       c.1080
 G  E  S  L  C  F  V  Q  H  V  A  S  G  L  W  L  T  Y  A  A         p.360

          .         .         .         .   | 12     .         .    g.23082
 CCAGACCCCAAGGCCCTGCGGCTCGGCGTGCTCAAGAAGAAG | GCCATGCTGCACCAGGAG    c.1140
 P  D  P  K  A  L  R  L  G  V  L  K  K  K   | A  M  L  H  Q  E      p.380

          .         .         .         .         .         .       g.23142
 GGCCACATGGACGACGCACTGTCGCTGACCCGCTGCCAGCAGGAGGAGTCCCAGGCCGCC       c.1200
 G  H  M  D  D  A  L  S  L  T  R  C  Q  Q  E  E  S  Q  A  A         p.400

          .         .         .         .     | 13   .         .    g.24135
 CGCATGATCCACAGCACCAATGGCCTATACAACCAGTTCATCAA | GAGCCTGGACAGCTTC    c.1260
 R  M  I  H  S  T  N  G  L  Y  N  Q  F  I  K  |  S  L  D  S  F      p.420

          .         .         .         .         .         .       g.24195
 AGCGGGAAGCCACGGGGCTCGGGGCCACCCGCTGGCACGGCGCTGCCCATCGAGGGCGTT       c.1320
 S  G  K  P  R  G  S  G  P  P  A  G  T  A  L  P  I  E  G  V         p.440

          .         .         .         .         .         .       g.24255
 ATCCTGAGCCTGCAGGACCTCATCATCTACTTCGAGCCTCCCTCCGAGGACTTGCAGCAC       c.1380
 I  L  S  L  Q  D  L  I  I  Y  F  E  P  P  S  E  D  L  Q  H         p.460

          .         .         .         .         .         .       g.24315
 GAGGAGAAGCAGAGCAAGCTGCGAAGCCTGCGCAACCGCCAGAGCCTCTTCCAGGAGGAG       c.1440
 E  E  K  Q  S  K  L  R  S  L  R  N  R  Q  S  L  F  Q  E  E         p.480

  | 14       .         .         .         .         .         .    g.26595
  | GGGATGCTCTCCATGGTCCTGAATTGCATAGACCGCCTAAATGTCTACACCACTGCTGCC    c.1500
  | G  M  L  S  M  V  L  N  C  I  D  R  L  N  V  Y  T  T  A  A      p.500

          .         .         .         .         .         .       g.26655
 CACTTTGCTGAGTTTGCAGGGGAGGAGGCAGCCGAGTCCTGGAAAGAGATTGTGAATCTT       c.1560
 H  F  A  E  F  A  G  E  E  A  A  E  S  W  K  E  I  V  N  L         p.520

          .       | 15 .         .         .         .         .    g.26795
 CTCTATGAACTCCTAG | CTTCTCTAATCCGTGGCAATCGTAGCAACTGTGCCCTCTTCTCC    c.1620
 L  Y  E  L  L  A |   S  L  I  R  G  N  R  S  N  C  A  L  F  S      p.540

          .         .         .         .         .   | 16     .    g.26941
 ACAAACTTGGACTGGCTGGTCAGCAAGCTGGATCGGCTGGAGGCCTCGTCTG | GCATCCTG    c.1680
 T  N  L  D  W  L  V  S  K  L  D  R  L  E  A  S  S  G |   I  L      p.560

          .         .         .         .         .         .       g.27001
 GAGGTCCTGTACTGTGTCCTCATTGAGAGTCCAGAGGTTCTGAACATCATCCAGGAGAAT       c.1740
 E  V  L  Y  C  V  L  I  E  S  P  E  V  L  N  I  I  Q  E  N         p.580

          .         .         .         .         .  | 17      .    g.28806
 CACATCAAGTCCATCATCTCCCTCCTGGACAAGCATGGGAGGAACCACAAG | GTCCTGGAC    c.1800
 H  I  K  S  I  I  S  L  L  D  K  H  G  R  N  H  K   | V  L  D      p.600

          .         .         .         .         .         .       g.28866
 GTGCTATGCTCCCTGTGTGTGTGTAATGGTGTGGCTGTACGCTCCAACCAAGATCTTATT       c.1860
 V  L  C  S  L  C  V  C  N  G  V  A  V  R  S  N  Q  D  L  I         p.620

          .         .         .         .         .         .       g.28926
 ACTGAGAACTTGCTGCCTGGCCGTGAGCTTCTGCTGCAGACAAACCTCATCAACTATGTC       c.1920
 T  E  N  L  L  P  G  R  E  L  L  L  Q  T  N  L  I  N  Y  V         p.640

       | 18  .         .         .         .         .         .    g.29406
 ACCAG | CATCCGCCCCAACATCTTTGTGGGCCGAGCGGAAGGCACCACGCAGTACAGCAAA    c.1980
 T  S  |  I  R  P  N  I  F  V  G  R  A  E  G  T  T  Q  Y  S  K      p.660

          .         .         .         .         .         .       g.29466
 TGGTACTTTGAGGTGATGGTGGACGAGGTGACTCCATTTCTGACAGCTCAGGCCACCCAC       c.2040
 W  Y  F  E  V  M  V  D  E  V  T  P  F  L  T  A  Q  A  T  H         p.680

          .         .         .         .         .         .       g.29526
 TTGCGGGTGGGCTGGGCCCTCACCGAGGGCTACACCCCCTACCCTGGGGCCGGCGAGGGC       c.2100
 L  R  V  G  W  A  L  T  E  G  Y  T  P  Y  P  G  A  G  E  G         p.700

          .         .         .         .         .         .       g.29586
 TGGGGCGGCAACGGGGTCGGCGATGACCTCTATTCCTACGGCTTTGATGGACTGCATCTC       c.2160
 W  G  G  N  G  V  G  D  D  L  Y  S  Y  G  F  D  G  L  H  L         p.720

         | 19.         .         .         .         .         .    g.30499
 TGGACAG | GACACGTGGCACGCCCAGTGACTTCCCCAGGGCAGCACCTCCTGGCCCCTGAA    c.2220
 W  T  G |   H  V  A  R  P  V  T  S  P  G  Q  H  L  L  A  P  E      p.740

          .         .         .         .         .         .       g.30559
 GACGTGATCAGCTGCTGCCTGGACCTCAGCGTGCCGTCCATCTCCTTCCGCATCAACGGC       c.2280
 D  V  I  S  C  C  L  D  L  S  V  P  S  I  S  F  R  I  N  G         p.760

          .         .         .         .         .         .       g.30619
 TGCCCCGTGCAGGGTGTCTTTGAGTCCTTCAACCTGGACGGGCTCTTCTTCCCTGTTGTC       c.2340
 C  P  V  Q  G  V  F  E  S  F  N  L  D  G  L  F  F  P  V  V         p.780

          .         . | 20       .         .         .         .    g.31715
 AGCTTCTCGGCTGGTGTCAA | GGTGCGGTTCCTCCTTGGTGGCCGCCATGGTGAATTCAAG    c.2400
 S  F  S  A  G  V  K  |  V  R  F  L  L  G  G  R  H  G  E  F  K      p.800

          .         .         .         .         .         .       g.31775
 TTCCTGCCCCCACCTGGCTATGCTCCATGCCATGAGGCTGTGCTCCCTCGAGAGCGACTC       c.2460
 F  L  P  P  P  G  Y  A  P  C  H  E  A  V  L  P  R  E  R  L         p.820

          .         .         .         .         .         .       g.31835
 CATCTTGAACCCATCAAGGAGTATCGACGGGAGGGGCCCCGGGGGCCTCACCTGGTGGGC       c.2520
 H  L  E  P  I  K  E  Y  R  R  E  G  P  R  G  P  H  L  V  G         p.840

          .         .         .         .         .        | 21.    g.34726
 CCCAGTCGCTGCCTCTCACACACCGACTTCGTGCCCTGCCCTGTGGACACTGTCCAG | ATT    c.2580
 P  S  R  C  L  S  H  T  D  F  V  P  C  P  V  D  T  V  Q   | I      p.860

          .         .         .         .         .         .       g.34786
 GTCCTGCCGCCCCATCTGGAGCGCATTCGGGAGAAGCTGGCGGAGAACATCCACGAGCTC       c.2640
 V  L  P  P  H  L  E  R  I  R  E  K  L  A  E  N  I  H  E  L         p.880

          .         .         .         .   | 22     .         .    g.35065
 TGGGCGCTAACCCGCATCGAGCAGGGCTGGACCTACGGCCCG | GTTCGGGATGACAACAAG    c.2700
 W  A  L  T  R  I  E  Q  G  W  T  Y  G  P   | V  R  D  D  N  K      p.900

          .         .         .         .         .         .       g.35125
 AGGCTGCACCCGTGTCTTGTGGACTTCCACAGCCTTCCAGAGCCTGAGAGGAACTACAAC       c.2760
 R  L  H  P  C  L  V  D  F  H  S  L  P  E  P  E  R  N  Y  N         p.920

          .         .       | 23 .         .         .         .    g.35973
 CTGCAGATGTCTGGGGAGACGCTCAA | GACTCTGCTGGCTCTGGGCTGCCACGTGGGCATG    c.2820
 L  Q  M  S  G  E  T  L  K  |  T  L  L  A  L  G  C  H  V  G  M      p.940

          .         .         .         .         . | 24       .    g.37401
 GCGGATGAGAAGGCGGAGGACAACCTGAAGAAGACAAAACTCCCCAAGAC | GTATATGATG    c.2880
 A  D  E  K  A  E  D  N  L  K  K  T  K  L  P  K  T  |  Y  M  M      p.960

          .         .         .         .         .         .       g.37461
 AGCAATGGGTACAAGCCGGCTCCGCTGGACCTGAGCCACGTGCGGCTGACGCCGGCGCAG       c.2940
 S  N  G  Y  K  P  A  P  L  D  L  S  H  V  R  L  T  P  A  Q         p.980

          .         .         .         .         .         .       g.37521
 ACGACACTGGTGGACCGTCTGGCAGAAAATGGGCACAACGTGTGGGCCCGAGACCGCGTG       c.3000
 T  T  L  V  D  R  L  A  E  N  G  H  N  V  W  A  R  D  R  V         p.1000

          .         .         .         .         .         .       g.37581
 GGCCAGGGCTGGAGCTACAGCGCAGTGCAGGACATCCCAGCGCGCCGAAACCCTCGGCTG       c.3060
 G  Q  G  W  S  Y  S  A  V  Q  D  I  P  A  R  R  N  P  R  L         p.1020

          .         .         .         .         .         .       g.37641
 GTGCCCTACCGCCTGCTGGATGAAGCCACCAAGCGCAGCAACCGGGACAGCCTCTGCCAG       c.3120
 V  P  Y  R  L  L  D  E  A  T  K  R  S  N  R  D  S  L  C  Q         p.1040

          .         .         .         .         .         | 25    g.38912
 GCCGTGCGCACCCTCCTGGGCTACGGCTACAACATCGAGCCTCCTGACCAGGAGCCCA | GT    c.3180
 A  V  R  T  L  L  G  Y  G  Y  N  I  E  P  P  D  Q  E  P  S |       p.1060

          .         .         .         .         .         .       g.38972
 CAGGTGGAGAACCAGTCTCGTTGTGACCGGGTGCGCATCTTCCGGGCAGAGAAATCCTAT       c.3240
 Q  V  E  N  Q  S  R  C  D  R  V  R  I  F  R  A  E  K  S  Y         p.1080

          .         .         .         .         .         .       g.39032
 ACAGTGCAGAGCGGCCGCTGGTACTTCGAGTTTGAAGCAGTCACCACAGGCGAGATGCGC       c.3300
 T  V  Q  S  G  R  W  Y  F  E  F  E  A  V  T  T  G  E  M  R         p.1100

          .         .         .         .         .         .       g.39092
 GTGGGCTGGGCGAGGCCCGAGCTGAGGCCTGATGTAGAGCTGGGAGCTGACGAGCTGGCC       c.3360
 V  G  W  A  R  P  E  L  R  P  D  V  E  L  G  A  D  E  L  A         p.1120

          .         .  | 26      .         .         .         .    g.40305
 TATGTCTTCAATGGGCACCGC | GGCCAGCGCTGGCACTTGGGCAGTGAACCATTTGGGCGC    c.3420
 Y  V  F  N  G  H  R   | G  Q  R  W  H  L  G  S  E  P  F  G  R      p.1140

          .         .         .         .         .         .       g.40365
 CCCTGGCAGCCGGGCGATGTCGTTGGCTGTATGATCGACCTCACAGAGAACACCATTATC       c.3480
 P  W  Q  P  G  D  V  V  G  C  M  I  D  L  T  E  N  T  I  I         p.1160

          .         .         .         .         .         .       g.40425
 TTCACCCTCAATGGCGAGGTCCTCATGTCTGACTCAGGCTCCGAAACAGCCTTCCGGGAG       c.3540
 F  T  L  N  G  E  V  L  M  S  D  S  G  S  E  T  A  F  R  E         p.1180

          .       | 27 .         .         .         .         .    g.40649
 ATTGAGATTGGGGACG | GCTTCCTGCCCGTCTGCAGCTTGGGACCTGGCCAGGTGGGTCAT    c.3600
 I  E  I  G  D  G |   F  L  P  V  C  S  L  G  P  G  Q  V  G  H      p.1200

          .         .         .         .         .         .       g.40709
 CTGAACCTGGGCCAGGACGTGAGCTCTCTGAGGTTCTTTGCCATCTGTGGCCTCCAGGAA       c.3660
 L  N  L  G  Q  D  V  S  S  L  R  F  F  A  I  C  G  L  Q  E         p.1220

          .         .         .         .         .         .       g.40769
 GGCTTCGAGCCATTTGCCATCAACATGCAGCGCCCAGTCACCACCTGGTTCAGCAAAGGC       c.3720
 G  F  E  P  F  A  I  N  M  Q  R  P  V  T  T  W  F  S  K  G         p.1240

          .         .         .         .      | 28  .         .    g.44692
 CTGCCCCAGTTTGAGCCAGTGCCCCTTGAACACCCTCACTATGAG | GTATCCCGAGTGGAC    c.3780
 L  P  Q  F  E  P  V  P  L  E  H  P  H  Y  E   | V  S  R  V  D      p.1260

          .         .         .         .         .         .       g.44752
 GGCACTGTGGACACGCCCCCCTGCCTGCGCCTGACCCACCGCACCTGGGGCTCCCAGAAC       c.3840
 G  T  V  D  T  P  P  C  L  R  L  T  H  R  T  W  G  S  Q  N         p.1280

          .         .         .         .         .         .       g.44812
 AGCCTGGTGGAGATGCTTTTCCTGCGGCTGAGCCTCCCAGTCCAGTTCCACCAGCACTTC       c.3900
 S  L  V  E  M  L  F  L  R  L  S  L  P  V  Q  F  H  Q  H  F         p.1300

          .         .         .         .         .         .       g.44872
 CGCTGCACTGCAGGGGCCACCCCGCTGGCACCTCCTGGCCTGCAGCCCCCCGCCGAGGAC       c.3960
 R  C  T  A  G  A  T  P  L  A  P  P  G  L  Q  P  P  A  E  D         p.1320

          .         .         .         .         .         .       g.44932
 GAGGCCCGGGCGGCGGAACCCGACCCTGACTACGAAAACCTGCGCCGCTCAGCTGGGGGC       c.4020
 E  A  R  A  A  E  P  D  P  D  Y  E  N  L  R  R  S  A  G  G         p.1340

          .         .         .         .         .         .       g.44992
 TGGAGCGAGGCAGAGAACGGCAAAGAAGGGACTGCGAAGGAGGGCGCCCCCGGGGGCACC       c.4080
 W  S  E  A  E  N  G  K  E  G  T  A  K  E  G  A  P  G  G  T         p.1360

          .         .         .         .         .         .       g.45052
 CCGCAGGCGGGGGGAGAGGCGCAGCCCGCCAGGGCGGAGAATGAGAAGGATGCCACCACC       c.4140
 P  Q  A  G  G  E  A  Q  P  A  R  A  E  N  E  K  D  A  T  T         p.1380

          .         . | 29       .         .         .         .    g.46658
 GAGAAGAACAAGAAGAGAGG | CTTCTTATTCAAGGCCAAGAAGGTCGCCATGATGACCCAG    c.4200
 E  K  N  K  K  R  G  |  F  L  F  K  A  K  K  V  A  M  M  T  Q      p.1400

          .         .         .         .         .         .       g.46718
 CCACCGGCCACCCCCACGCTGCCCCGACTCCCTCACGACGTGGTGCCTGCAGACAACCGC       c.4260
 P  P  A  T  P  T  L  P  R  L  P  H  D  V  V  P  A  D  N  R         p.1420

          .         .         .    | 30    .         .         .    g.49037
 GATGACCCCGAGATCATCCTCAACACCACCACG | TACTATTACTCCGTGAGGGTCTTTGCT    c.4320
 D  D  P  E  I  I  L  N  T  T  T   | Y  Y  Y  S  V  R  V  F  A      p.1440

          .         .         .         .         .         .       g.49097
 GGACAGGAGCCCAGCTGCGTGTGGGCGGGCTGGGTCACCCCTGACTACCATCAGCACGAC       c.4380
 G  Q  E  P  S  C  V  W  A  G  W  V  T  P  D  Y  H  Q  H  D         p.1460

          .         .         .         .         .         .       g.49157
 ATGAGCTTCGACCTCAGCAAGGTCCGGGTCGTGACGGTGACCATGGGGGATGAACAAGGC       c.4440
 M  S  F  D  L  S  K  V  R  V  V  T  V  T  M  G  D  E  Q  G         p.1480

          .     | 31   .         .         .         .         .    g.49781
 AACGTCCACAGCAG | CCTCAAGTGTAGCAACTGCTACATGGTGTGGGGCGGAGACTTTGTG    c.4500
 N  V  H  S  S  |  L  K  C  S  N  C  Y  M  V  W  G  G  D  F  V      p.1500

          .         .         .         .         .         .       g.49841
 AGTCCCGGGCAGCAGGGCCGGATCAGCCACACGGACCTTGTCATTGGGTGCCTGGTGGAC       c.4560
 S  P  G  Q  Q  G  R  I  S  H  T  D  L  V  I  G  C  L  V  D         p.1520

          .         .         .         .         .         .       g.49901
 TTGGCCACTGGCTTAATGACCTTTACAGCCAATGGCAAAGAGAGCAACACCTTTTTCCAG       c.4620
 L  A  T  G  L  M  T  F  T  A  N  G  K  E  S  N  T  F  F  Q         p.1540

  | 32       .         .         .         .         .         .    g.54387
  | GTGGAACCCAACACTAAGCTATTTCCTGCCGTCTTCGTCCTGCCCACCCACCAGAACGTC    c.4680
  | V  E  P  N  T  K  L  F  P  A  V  F  V  L  P  T  H  Q  N  V      p.1560

          .         .        | 33.         .         .         .    g.54623
 ATCCAGTTTGAGCTGGGGAAGCAGAAG | AACATCATGCCGTTGTCAGCCGCCATGTTCCAA    c.4740
 I  Q  F  E  L  G  K  Q  K   | N  I  M  P  L  S  A  A  M  F  Q      p.1580

          .         .         .         .         .         .       g.54683
 AGCGAGCGCAAGAACCCGGCCCCGCAGTGCCCACCGCGGCTGGAGATGCAGATGCTGATG       c.4800
 S  E  R  K  N  P  A  P  Q  C  P  P  R  L  E  M  Q  M  L  M         p.1600

          .         .         .         .         .         .       g.54743
 CCAGTGTCCTGGAGCCGCATGCCCAACCACTTCCTGCAGGTGGAGACGAGGCGTGCCGGC       c.4860
 P  V  S  W  S  R  M  P  N  H  F  L  Q  V  E  T  R  R  A  G         p.1620

          .         .         .         .         .         .       g.54803
 GAGCGGCTGGGCTGGGCCGTGCAGTGCCAGGAGCCGCTGACCATGATGGCGCTGCACATC       c.4920
 E  R  L  G  W  A  V  Q  C  Q  E  P  L  T  M  M  A  L  H  I         p.1640

          .     | 34   .         .         .         .         .    g.56936
 CCCGAGGAGAACCG | GTGCATGGACATCCTGGAGCTGTCGGAGCGCCTGGACCTGCAGCGC    c.4980
 P  E  E  N  R  |  C  M  D  I  L  E  L  S  E  R  L  D  L  Q  R      p.1660

          .         .         .         .         .         .       g.56996
 TTCCACTCGCACACCCTGCGCCTCTACCGCGCTGTGTGCGCCCTGGGCAACAATCGCGTG       c.5040
 F  H  S  H  T  L  R  L  Y  R  A  V  C  A  L  G  N  N  R  V         p.1680

          .         .         .         .         .         .       g.57056
 GCGCACGCTCTGTGCAGCCACGTAGACCAAGCTCAGCTGCTGCACGCCCTGGAGGACGCG       c.5100
 A  H  A  L  C  S  H  V  D  Q  A  Q  L  L  H  A  L  E  D  A         p.1700

          .         .         .         .         .         .       g.57116
 CACCTGCCAGGCCCACTGCGCGCAGGCTACTATGACCTCCTCATCAGCATCCACCTCGAA       c.5160
 H  L  P  G  P  L  R  A  G  Y  Y  D  L  L  I  S  I  H  L  E         p.1720

          .         .         .         .         .         .       g.57176
 AGTGCCTGCCGCAGCCGCCGCTCCATGCTCTCTGAATACATCGTGCCCCTCACGCCTGAG       c.5220
 S  A  C  R  S  R  R  S  M  L  S  E  Y  I  V  P  L  T  P  E         p.1740

          .         .         .         .         .         .       g.57236
 ACCCGCGCCATCACGCTCTTCCCTCCTGGAAGGAGCACAGAAAATGGTCACCCCCGGCAT       c.5280
 T  R  A  I  T  L  F  P  P  G  R  S  T  E  N  G  H  P  R  H         p.1760

          .         .         .         .         .         .       g.57296
 GGCCTGCCGGGAGTTGGAGTCACCACTTCGCTGAGGCCCCCGCATCATTTCTCGCCCCCC       c.5340
 G  L  P  G  V  G  V  T  T  S  L  R  P  P  H  H  F  S  P  P         p.1780

          .         .         .         .         .         .       g.57356
 TGTTTCGTGGCCGCTCTGCCAGCTGCTGGGGCAGCAGAGGCCCCGGCCCGCCTCAGCCCT       c.5400
 C  F  V  A  A  L  P  A  A  G  A  A  E  A  P  A  R  L  S  P         p.1800

          .         .         .         .         .         .       g.57416
 GCCATCCCGCTGGAGGCCCTGCGGGACAAGGCACTGAGGATGCTGGGGGAGGCGGTGCGC       c.5460
 A  I  P  L  E  A  L  R  D  K  A  L  R  M  L  G  E  A  V  R         p.1820

          .         .         .         .         .         .       g.57476
 GACGGTGGGCAGCACGCTCGCGACCCCGTCGGGGGCTCCGTGGAGTTCCAGTTTGTGCCT       c.5520
 D  G  G  Q  H  A  R  D  P  V  G  G  S  V  E  F  Q  F  V  P         p.1840

          .         .        | 35.         .         .         .    g.60510
 GTGCTCAAGCTCGTGTCCACCCTGCTG | GTGATGGGCATCTTTGGCGATGAGGATGTGAAA    c.5580
 V  L  K  L  V  S  T  L  L   | V  M  G  I  F  G  D  E  D  V  K      p.1860

          .         .         .         .         .         .       g.60570
 CAGATCTTGAAGATGATTGAGCCTGAGGTCTTCACTGAGGAAGAAGAGGAGGAGGACGAG       c.5640
 Q  I  L  K  M  I  E  P  E  V  F  T  E  E  E  E  E  E  D  E         p.1880

          .         .         .         .         .         .       g.60630
 GAGGAAGAGGGTGAAGAGGAAGATGAGGAGGAGAAGGAGGAGGATGAGGAGGAAACAGCA       c.5700
 E  E  E  G  E  E  E  D  E  E  E  K  E  E  D  E  E  E  T  A         p.1900

          .         .         .         .         .         .       g.60690
 CAGGAAAAGGAAGATGAGGAAAAAGAGGAAGAGGAGGCAGCAGAAGGGGAGAAAGAAGAA       c.5760
 Q  E  K  E  D  E  E  K  E  E  E  E  A  A  E  G  E  K  E  E         p.1920

          .         .         .         .         .     | 36   .    g.61382
 GGCTTGGAGGAAGGGCTGCTCCAGATGAAGTTGCCAGAGTCTGTGAAGTTACAG | ATGTGC    c.5820
 G  L  E  E  G  L  L  Q  M  K  L  P  E  S  V  K  L  Q   | M  C      p.1940

          .         .         .         .         .         .       g.61442
 CACCTGCTGGAGTATTTCTGTGACCAAGAGCTGCAGCACCGTGTGGAGTCCCTGGCAGCC       c.5880
 H  L  L  E  Y  F  C  D  Q  E  L  Q  H  R  V  E  S  L  A  A         p.1960

          .         .         .         .         .         .       g.61502
 TTTGCGGAGCGCTATGTGGACAAGCTCCAGGCCAACCAGCGGAGCCGCTATGGCCTCCTC       c.5940
 F  A  E  R  Y  V  D  K  L  Q  A  N  Q  R  S  R  Y  G  L  L         p.1980

          .         .         .         .         .         .       g.61562
 ATAAAAGCCTTCAGCATGACCGCAGCAGAGACTGCAAGACGTACCCGCGAGTTCCGCTCC       c.6000
 I  K  A  F  S  M  T  A  A  E  T  A  R  R  T  R  E  F  R  S         p.2000

          .      | 37  .         .         .         .         .    g.61966
 CCACCCCAGGAACAG | ATCAATATGCTATTGCAATTCAAAGATGGTACAGATGAGGAAGAC    c.6060
 P  P  Q  E  Q   | I  N  M  L  L  Q  F  K  D  G  T  D  E  E  D      p.2020

          .         .         .         .         .         .       g.62026
 TGTCCTCTCCCTGAAGAGATTCGACAGGATTTGCTTGACTTTCATCAAGACCTGCTGGCA       c.6120
 C  P  L  P  E  E  I  R  Q  D  L  L  D  F  H  Q  D  L  L  A         p.2040

         | 38.         .         .         .         .         .    g.63843
 CACTGTG | GAATTCAGCTAGATGGAGAGGAGGAGGAACCAGAGGAAGAGACCACCCTGGGC    c.6180
 H  C  G |   I  Q  L  D  G  E  E  E  E  P  E  E  E  T  T  L  G      p.2060

          .         .         .         .         .         .       g.63903
 AGCCGCCTCATGAGCCTGTTGGAGAAAGTGCGGCTGGTGAAGAAGAAGGAAGAGAAACCT       c.6240
 S  R  L  M  S  L  L  E  K  V  R  L  V  K  K  K  E  E  K  P         p.2080

          .         .         .     | 39   .         .         .    g.65678
 GAGGAGGAGCGGTCAGCAGAGGAGAGCAAACCCC | GGTCCCTGCAGGAGCTGGTGTCCCAC    c.6300
 E  E  E  R  S  A  E  E  S  K  P  R |   S  L  Q  E  L  V  S  H      p.2100

          .         .         .         .         .         .       g.65738
 ATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCCGAGCTGGTGCGGGCCATG       c.6360
 M  V  V  R  W  A  Q  E  D  F  V  Q  S  P  E  L  V  R  A  M         p.2120

          .         .         .         .         .         .       g.65798
 TTCAGCCTCCTGCACCGGCAGTACGACGGGCTGGGTGAGCTGCTGCGTGCCCTGCCGCGG       c.6420
 F  S  L  L  H  R  Q  Y  D  G  L  G  E  L  L  R  A  L  P  R         p.2140

          .         .         .         .         .         .       g.65858
 GCGTACACCATCTCACCGTCCTCCGTGGAAGACACCATGAGCCTGCTCGAGTGCCTCGGC       c.6480
 A  Y  T  I  S  P  S  S  V  E  D  T  M  S  L  L  E  C  L  G         p.2160

          .         .         .         .         .         .       g.65918
 CAGATCCGCTCGCTGCTCATCGTGCAGATGGGCCCCCAGGAGGAGAACCTCATGATCCAG       c.6540
 Q  I  R  S  L  L  I  V  Q  M  G  P  Q  E  E  N  L  M  I  Q         p.2180

          | 40         .         .         .         .         .    g.67567
 AGCATCGG | GAACATCATGAACAACAAAGTCTTCTACCAACACCCGAACCTGATGAGGGCG    c.6600
 S  I  G  |  N  I  M  N  N  K  V  F  Y  Q  H  P  N  L  M  R  A      p.2200

          .         .         .         .         .         .       g.67627
 CTGGGCATGCACGAGACGGTCATGGAGGTCATGGTCAACGTCCTCGGGGGCGGCGAGTCC       c.6660
 L  G  M  H  E  T  V  M  E  V  M  V  N  V  L  G  G  G  E  S         p.2220

     | 41    .         .         .         .         .         .    g.67766
 AAG | GAGATCCGCTTCCCCAAGATGGTGACAAGCTGCTGCCGCTTCCTCTGCTATTTCTGC    c.6720
 K   | E  I  R  F  P  K  M  V  T  S  C  C  R  F  L  C  Y  F  C      p.2240

          .         .         .         .         .         .       g.67826
 CGAATCAGCCGGCAGAACCAGCGCTCCATGTTTGACCACCTGAGCTACCTGCTGGAGAAC       c.6780
 R  I  S  R  Q  N  Q  R  S  M  F  D  H  L  S  Y  L  L  E  N         p.2260

          .       | 42 .         .         .         .         .    g.68204
 AGTGGCATCGGCCTGG | GCATGCAGGGCTCCACGCCCCTGGACGTGGCTGCTGCCTCCGTC    c.6840
 S  G  I  G  L  G |   M  Q  G  S  T  P  L  D  V  A  A  A  S  V      p.2280

          .         .         .         .         .  | 43      .    g.70417
 ATTGACAACAATGAGCTGGCCTTGGCATTGCAGGAGCAGGACCTGGAAAAG | GTTGTGTCC    c.6900
 I  D  N  N  E  L  A  L  A  L  Q  E  Q  D  L  E  K   | V  V  S      p.2300

          .         .         .         .         .         .       g.70477
 TACCTGGCAGGCTGTGGCCTCCAGAGCTGCCCCATGCTTGTGGCCAAAGGGTACCCAGAC       c.6960
 Y  L  A  G  C  G  L  Q  S  C  P  M  L  V  A  K  G  Y  P  D         p.2320

          .         .         .         .         .         .       g.70537
 ATTGGCTGGAACCCCTGTGGTGGAGAGCGCTACCTGGACTTCCTGCGCTTTGCTGTCTTC       c.7020
 I  G  W  N  P  C  G  G  E  R  Y  L  D  F  L  R  F  A  V  F         p.2340

         | 44.         .         .         .         .         .    g.70988
 GTCAACG | GCGAGAGCGTGGAGGAGAACGCCAATGTGGTGGTGCGGCTGCTCATCCGGAAG    c.7080
 V  N  G |   E  S  V  E  E  N  A  N  V  V  V  R  L  L  I  R  K      p.2360

          .         .         .         .         .         .       g.71048
 CCTGAGTGCTTCGGACCCGCCCTGCGGGGTGAGGGTGGCTCAGGGCTGCTGGCTGCCATC       c.7140
 P  E  C  F  G  P  A  L  R  G  E  G  G  S  G  L  L  A  A  I         p.2380

          .         .         .         .         .         .       g.71108
 GAAGAGGCCATCCGCATCTCCGAGGACCCTGCGAGGGATGGCCCAGGCATCCGCAGGGAC       c.7200
 E  E  A  I  R  I  S  E  D  P  A  R  D  G  P  G  I  R  R  D         p.2400

          .     | 45   .         .         .         .         .    g.71254
 CGGCGGCGCGAGCA | CTTTGGTGAGGAACCGCCTGAAGAAAACCGGGTGCACCTGGGACAC    c.7260
 R  R  R  E  H  |  F  G  E  E  P  P  E  E  N  R  V  H  L  G  H      p.2420

          .         .         .         .         .         .       g.71314
 GCCATCATGTCCTTCTATGCCGCCTTGATCGACCTGCTCGGACGCTGTGCACCAGAGATG       c.7320
 A  I  M  S  F  Y  A  A  L  I  D  L  L  G  R  C  A  P  E  M         p.2440

     | 46    .         .         .         .         .         .    g.71963
 CAT | CTAATCCAAGCCGGCAAGGGTGAGGCCCTGCGGATCCGCGCCATCCTCCGCTCCCTT    c.7380
 H   | L  I  Q  A  G  K  G  E  A  L  R  I  R  A  I  L  R  S  L      p.2460

          .         .         .         .         .         .       g.72023
 GTGCCCTTGGAGGACCTTGTGGGCATCATCAGCCTCCCACTGCAGATTCCCACCCTGGGC       c.7440
 V  P  L  E  D  L  V  G  I  I  S  L  P  L  Q  I  P  T  L  G         p.2480

      | 47   .         .         .         .         .         .    g.72177
 AAAG | ATGGGGCTCTGGTGCAGCCAAAGATGTCAGCATCCTTCGTGCCGGACCACAAGGCG    c.7500
 K  D |   G  A  L  V  Q  P  K  M  S  A  S  F  V  P  D  H  K  A      p.2500

          .         .         .         .         .         .       g.72237
 TCCATGGTGCTCTTCCTGGACCGTGTGTATGGCATCGAGAACCAGGACTTCTTGCTGCAC       c.7560
 S  M  V  L  F  L  D  R  V  Y  G  I  E  N  Q  D  F  L  L  H         p.2520

          .         .         .         .         .     | 48   .    g.73813
 GTGCTGGACGTGGGGTTCCTGCCCGACATGAGGGCAGCCGCCTCGCTGGACACG | GCCACT    c.7620
 V  L  D  V  G  F  L  P  D  M  R  A  A  A  S  L  D  T   | A  T      p.2540

          .         .         .         .         .         .       g.73873
 TTCAGCACCACCGAGATGGCGCTGGCGCTGAACCGCTACCTGTGCCTGGCCGTGCTGCCG       c.7680
 F  S  T  T  E  M  A  L  A  L  N  R  Y  L  C  L  A  V  L  P         p.2560

          .         .         .         .         .         .       g.73933
 CTCATCACCAAGTGTGCGCCGCTCTTTGCGGGCACAGAACACCGCGCCATCATGGTGGAC       c.7740
 L  I  T  K  C  A  P  L  F  A  G  T  E  H  R  A  I  M  V  D         p.2580

          .         .         .         .         .         .       g.73993
 TCTATGCTGCATACCGTGTACCGCCTGTCTCGGGGTCGTTCGCTCACCAAGGCGCAGCGT       c.7800
 S  M  L  H  T  V  Y  R  L  S  R  G  R  S  L  T  K  A  Q  R         p.2600

          .         .         .      | 49  .         .         .    g.74205
 GACGTCATCGAGGACTGCCTCATGTCGCTCTGCAG | GTACATCCGCCCGTCGATGCTGCAG    c.7860
 D  V  I  E  D  C  L  M  S  L  C  R  |  Y  I  R  P  S  M  L  Q      p.2620

          .         .         .         .         .         .       g.74265
 CACCTGTTGCGCCGCCTGGTGTTCGACGTGCCCATCCTCAACGAGTTCGCCAAGATGCCA       c.7920
 H  L  L  R  R  L  V  F  D  V  P  I  L  N  E  F  A  K  M  P         p.2640

        | 50 .         .         .         .         .         .    g.75574
 CTCAAG | CTCCTCACCAACCACTATGAGCGCTGTTGGAAGTACTACTGCCTACCCACGGGC    c.7980
 L  K   | L  L  T  N  H  Y  E  R  C  W  K  Y  Y  C  L  P  T  G      p.2660

          .         .         .         .         .         .       g.75634
 TGGGCCAACTTCGGGGTCACCTCAGAGGAGGAGCTGCACCTCACACGGAAACTCTTCTGG       c.8040
 W  A  N  F  G  V  T  S  E  E  E  L  H  L  T  R  K  L  F  W         p.2680

          .         .        | 51.         .         .         .    g.76081
 GGCATCTTTGACTCTCTGGCCCATAAG | AAATACGACCCGGAGCTGTACCGCATGGCCATG    c.8100
 G  I  F  D  S  L  A  H  K   | K  Y  D  P  E  L  Y  R  M  A  M      p.2700

          .         .         .         .         .         .       g.76141
 CCTTGTCTGTGCGCCATTGCCGGGGCTCTGCCCCCCGACTATGTGGATGCCTCATACTCA       c.8160
 P  C  L  C  A  I  A  G  A  L  P  P  D  Y  V  D  A  S  Y  S         p.2720

          .         .         .         .         .         .       g.76201
 TCTAAGGCAGAGAAAAAGGCCACAGTGGATGCTGAAGGCAACTTTGATCCCCGGCCTGTG       c.8220
 S  K  A  E  K  K  A  T  V  D  A  E  G  N  F  D  P  R  P  V         p.2740

          .  | 52      .         .         .         .         .    g.76352
 GAGACCCTCAA | TGTGATCATCCCGGAGAAGCTGGACTCCTTCATTAACAAGTTTGCGGAG    c.8280
 E  T  L  N  |  V  I  I  P  E  K  L  D  S  F  I  N  K  F  A  E      p.2760

          .         .         . | 53       .         .         .    g.76639
 TACACACACGAGAAGTGGGCCTTCGACAAG | ATCCAGAACAACTGGTCCTATGGAGAGAAC    c.8340
 Y  T  H  E  K  W  A  F  D  K   | I  Q  N  N  W  S  Y  G  E  N      p.2780

          .         .         .         .         .         .       g.76699
 ATAGACGAGGAGCTGAAGACCCACCCCATGCTGAGGCCCTACAAGACCTTTTCAGAGAAG       c.8400
 I  D  E  E  L  K  T  H  P  M  L  R  P  Y  K  T  F  S  E  K         p.2800

  | 54       .         .         .         .         .         .    g.77166
  | GACAAAGAGATTTACCGCTGGCCCATCAAGGAGTCCCTGAAGGCCATGATTGCCTGGGAA    c.8460
  | D  K  E  I  Y  R  W  P  I  K  E  S  L  K  A  M  I  A  W  E      p.2820

          .         .         .         .         .         .       g.77226
 TGGACGATAGAGAAGGCCAGGGAGGGTGAGGAGGAGAAGACGGAAAAGAAAAAAACGCGG       c.8520
 W  T  I  E  K  A  R  E  G  E  E  E  K  T  E  K  K  K  T  R         p.2840

          .         .  | 55      .         .         .         .    g.77642
 AAGATATCACAAAGTGCCCAG | ACCTATGATCCTCGAGAAGGCTACAACCCTCAGCCCCCC    c.8580
 K  I  S  Q  S  A  Q   | T  Y  D  P  R  E  G  Y  N  P  Q  P  P      p.2860

          .         .         .       | 56 .         .         .    g.77795
 GACCTTAGTGCTGTTACCCTGTCCCGGGAGCTGCAG | GCCATGGCAGAACAACTGGCAGAA    c.8640
 D  L  S  A  V  T  L  S  R  E  L  Q   | A  M  A  E  Q  L  A  E      p.2880

          .         .         .         .         .   | 57     .    g.78137
 AATTACCACAACACGTGGGGACGGAAGAAGAAGCAGGAGCTGGAAGCCAAAG | GCGGTGGG    c.8700
 N  Y  H  N  T  W  G  R  K  K  K  Q  E  L  E  A  K  G |   G  G      p.2900

          .         .         .         .         .         .       g.78197
 ACCCACCCCCTGCTGGTCCCCTACGACACGCTCACGGCCAAGGAGAAGGCACGAGATCGA       c.8760
 T  H  P  L  L  V  P  Y  D  T  L  T  A  K  E  K  A  R  D  R         p.2920

          .         .         .         .         .       | 58 .    g.79016
 GAGAAGGCCCAGGAGCTACTGAAATTCCTGCAGATGAATGGCTACGCGGTTACAAG | AGGC    c.8820
 E  K  A  Q  E  L  L  K  F  L  Q  M  N  G  Y  A  V  T  R  |  G      p.2940

          .         .         .         .         .         .       g.79076
 CTTAAGGACATGGAACTGGACTCGTCTTCCATTGAAAAGCGGTTTGCCTTTGGCTTCCTG       c.8880
 L  K  D  M  E  L  D  S  S  S  I  E  K  R  F  A  F  G  F  L         p.2960

          .         .         .         .         .   | 59     .    g.81806
 CAGCAGCTGCTGCGCTGGATGGACATTTCTCAGGAGTTCATTGCCCACCTGG | AGGCTGTG    c.8940
 Q  Q  L  L  R  W  M  D  I  S  Q  E  F  I  A  H  L  E |   A  V      p.2980

          .         .         .         .         .         .       g.81866
 GTCAGCAGTGGGCGAGTGGAAAAGTCCCCACATGAACAGGAGATTAAATTCTTTGCCAAG       c.9000
 V  S  S  G  R  V  E  K  S  P  H  E  Q  E  I  K  F  F  A  K         p.3000

  | 60       .         .         .         .         .         .    g.82020
  | ATCCTGCTCCCTTTGATCAACCAGTACTTCACCAACCACTGCCTCTATTTCTTGTCCACT    c.9060
  | I  L  L  P  L  I  N  Q  Y  F  T  N  H  C  L  Y  F  L  S  T      p.3020

          .         .         .         .         .         .       g.82080
 CCGGCTAAAGTGCTGGGCAGCGGTGGCCACGCCTCTAACAAGGAGAAGGAAATGATCACC       c.9120
 P  A  K  V  L  G  S  G  G  H  A  S  N  K  E  K  E  M  I  T         p.3040

    | 61     .         .         .         .         .   | 62     . g.83380
 AG | CCTCTTCTGCAAACTTGCTGCTCTCGTCCGCCACCGAGTCTCTCTCTTTG | GGACAGAC c.9180
 S  |  L  F  C  K  L  A  A  L  V  R  H  R  V  S  L  F  G |   T  D   p.3060

          .         .         .         .         .    | 63    .    g.83552
 GCCCCAGCTGTGGTCAACTGTCTTCACATCCTGGCCCGCTCCCTGGATGCCAG | GACAGTG    c.9240
 A  P  A  V  V  N  C  L  H  I  L  A  R  S  L  D  A  R  |  T  V      p.3080

          .         .         .         .         .         .       g.83612
 ATGAAGTCAGGCCCTGAGATCGTGAAGGCTGGCCTCCGCTCCTTCTTCGAGAGTGCCTCG       c.9300
 M  K  S  G  P  E  I  V  K  A  G  L  R  S  F  F  E  S  A  S         p.3100

          .         .         .         .         .         .       g.83672
 GAGGACATCGAGAAGATGGTGGAGAACCTGCGGCTGGGCAAGGTGTCGCAGGCGCGCACC       c.9360
 E  D  I  E  K  M  V  E  N  L  R  L  G  K  V  S  Q  A  R  T         p.3120

          .         .         .         .         .         .       g.83732
 CAGGTGAAAGGCGTGGGCCAGAACCTCACCTACACCACTGTGGCACTGCTGCCGGTCCTC       c.9420
 Q  V  K  G  V  G  Q  N  L  T  Y  T  T  V  A  L  L  P  V  L         p.3140

          .         .         .         .         .   | 64     .    g.86334
 ACCACCCTCTTCCAGCACATCGCCCAGCACCAGTTCGGAGATGACGTCATCC | TGGACGAC    c.9480
 T  T  L  F  Q  H  I  A  Q  H  Q  F  G  D  D  V  I  L |   D  D      p.3160

          .         .         .         .         .         .       g.86394
 GTCCAGGTCTCTTGCTACCGAACGCTGTGCAGTATCTACTCCCTGGGAACCACCAAGAAC       c.9540
 V  Q  V  S  C  Y  R  T  L  C  S  I  Y  S  L  G  T  T  K  N         p.3180

          .     | 65   .         .         .         .         .    g.87433
 ACTTATGTGGAAAA | GCTTCGGCCAGCCCTCGGGGAGTGCCTGGCCCGTCTGGCAGCAGCC    c.9600
 T  Y  V  E  K  |  L  R  P  A  L  G  E  C  L  A  R  L  A  A  A      p.3200

          .         .         .         .         .         .       g.87493
 ATGCCGGTGGCGTTCCTGGAGCCGCAGCTGAACGAGTACAACGCCTGCTCCGTGTACACC       c.9660
 M  P  V  A  F  L  E  P  Q  L  N  E  Y  N  A  C  S  V  Y  T         p.3220

          .         .      | 66  .         .         .         .    g.88694
 ACCAAGTCTCCGCGGGAGCGGGCCA | TCCTGGGGCTCCCCAACAGTGTGGAGGAGATGTGT    c.9720
 T  K  S  P  R  E  R  A  I |   L  G  L  P  N  S  V  E  E  M  C      p.3240

          .         .         .         .         .         .       g.88754
 CCCGACATCCCGGTGCTGGAGCGGCTCATGGCAGACATTGGGGGGCTGGCCGAGTCAGGT       c.9780
 P  D  I  P  V  L  E  R  L  M  A  D  I  G  G  L  A  E  S  G         p.3260

          .         .         .         .         .         .       g.88814
 GCCCGCTACACAGAGATGCCGCATGTCATCGAGATCACGCTGCCCATGCTATGCAGCTAC       c.9840
 A  R  Y  T  E  M  P  H  V  I  E  I  T  L  P  M  L  C  S  Y         p.3280

          .         .         .         .         .         .       g.88874
 CTGCCCCGATGGTGGGAGCGCGGGCCCGAGGCACCCCCTTCCGCCCTGCCCGCCGGCGCC       c.9900
 L  P  R  W  W  E  R  G  P  E  A  P  P  S  A  L  P  A  G  A         p.3300

          .         .         .         .         .         .       g.88934
 CCCCCACCCTGCACAGCTGTCACCTCTGACCACCTCAACTCCCTGCTGGGGAATATCCTG       c.9960
 P  P  P  C  T  A  V  T  S  D  H  L  N  S  L  L  G  N  I  L         p.3320

          .         .         .         .         .         | 67    g.90516
 AGAATCATCGTCAACAACCTGGGCATTGACGAGGCCTCCTGGATGAAGCGGCTGGCTG | TG    c.10020
 R  I  I  V  N  N  L  G  I  D  E  A  S  W  M  K  R  L  A  V |       p.3340

          .         .         .         .         .         .       g.90576
 TTCGCACAGCCCATTGTGAGCCGTGCACGGCCGGAGCTCCTGCAGTCCCACTTCATCCCA       c.10080
 F  A  Q  P  I  V  S  R  A  R  P  E  L  L  Q  S  H  F  I  P         p.3360

          .         .         .         .         .         .       g.90636
 ACTATCGGGCGGCTGCGCAAGAGGGCAGGGAAGGTGGTGTCCGAGGAGGAGCAGCTGCGC       c.10140
 T  I  G  R  L  R  K  R  A  G  K  V  V  S  E  E  E  Q  L  R         p.3380

          .         .         .         .         .         .       g.90696
 CTGGAGGCCAAGGCGGAGGCCCAGGAGGGCGAGCTGCTGGTGCGGGACGAGTTCTCTGTG       c.10200
 L  E  A  K  A  E  A  Q  E  G  E  L  L  V  R  D  E  F  S  V         p.3400

          .         .         .         .         .          | 68    g.94329
 CTCTGCCGGGACCTCTACGCCCTGTATCCGCTGCTCATCCGCTACGTGGACAACAACAG | G    c.10260
 L  C  R  D  L  Y  A  L  Y  P  L  L  I  R  Y  V  D  N  N  R  |      p.3420

          .         .         .         .         .         .       g.94389
 GCGCAGTGGCTGACGGAGCCGAATCCCAGCGCGGAGGAGCTGTTCAGGATGGTGGGCGAG       c.10320
 A  Q  W  L  T  E  P  N  P  S  A  E  E  L  F  R  M  V  G  E         p.3440

          .         .        | 69.         .         .         .    g.94550
 ATCTTCATCTACTGGTCCAAGTCCCAC | AACTTCAAGCGCGAGGAGCAGAACTTTGTGGTC    c.10380
 I  F  I  Y  W  S  K  S  H   | N  F  K  R  E  E  Q  N  F  V  V      p.3460

          .         .         .         .         .         .       g.94610
 CAGAATGAGATCAACAACATGTCCTTCCTGACTGCTGACAACAAAAGCAAAATGGCTAAG       c.10440
 Q  N  E  I  N  N  M  S  F  L  T  A  D  N  K  S  K  M  A  K         p.3480

  | 70       .      | 71  .         .         .         .         . g.96677
  | GCGGGAGATATACAG | TCCGGTGGCTCGGACCAGGAACGCACCAAGAAGAAGCGCCGGGGG c.10500
  | A  G  D  I  Q   | S  G  G  S  D  Q  E  R  T  K  K  K  R  R  G   p.3500

          .         .         .         .         .         .       g.96737
 GACCGGTACTCTGTGCAGACGTCACTGATCGTGGCCACACTGAAGAAGATGCTGCCCATC       c.10560
 D  R  Y  S  V  Q  T  S  L  I  V  A  T  L  K  K  M  L  P  I         p.3520

          .         .         .         .         .         .       g.96797
 GGCCTGAATATGTGTGCGCCCACCGACCAAGACCTCATCACGCTGGCCAAGACCCGTTAC       c.10620
 G  L  N  M  C  A  P  T  D  Q  D  L  I  T  L  A  K  T  R  Y         p.3540

        | 72 .         .         .         .         .         .    g.98347
 GCCCTG | AAAGACACAGATGAGGAGGTCCGGGAATTTCTGCACAACAACCTTCACCTTCAG    c.10680
 A  L   | K  D  T  D  E  E  V  R  E  F  L  H  N  N  L  H  L  Q      p.3560

        | 73 .         .         .         .         .         .    g.99001
 GGAAAG | GTCGAAGGCTCCCCGTCTCTGCGCTGGCAGATGGCTCTGTACCGGGGCGTCCCG    c.10740
 G  K   | V  E  G  S  P  S  L  R  W  Q  M  A  L  Y  R  G  V  P      p.3580

          .         .         .         .         .         .       g.99061
 GGTCGCGAGGAGGACGCCGATGACCCCGAGAAAATCGTGCGCAGAGTCCAGGAAGTGTCA       c.10800
 G  R  E  E  D  A  D  D  P  E  K  I  V  R  R  V  Q  E  V  S         p.3600

          .         .     | 74   .         .         .         .    g.99642
 GCCGTGCTCTACTACCTGGACCAG | ACCGAGCACCCTTACAAGTCTAAGAAGGCCGTGTGG    c.10860
 A  V  L  Y  Y  L  D  Q   | T  E  H  P  Y  K  S  K  K  A  V  W      p.3620

          .         .         .         .         .         .       g.99702
 CACAAGCTTTTGTCCAAACAGCGCCGGCGGGCAGTCGTGGCCTGTTTCCGTATGACGCCC       c.10920
 H  K  L  L  S  K  Q  R  R  R  A  V  V  A  C  F  R  M  T  P         p.3640

          .        | 75.         .         .         .         .    g.99942
 CTGTACAACCTGCCCAC | GCACCGGGCATGTAACATGTTCCTGGAGAGCTACAAGGCTGCA    c.10980
 L  Y  N  L  P  T  |  H  R  A  C  N  M  F  L  E  S  Y  K  A  A      p.3660

          .         .         .         .         .     | 76   .    g.100257
 TGGATCCTGACTGAAGACCACAGTTTTGAGGACCGCATGATAGATGACCTTTCA | AAAGCT    c.11040
 W  I  L  T  E  D  H  S  F  E  D  R  M  I  D  D  L  S   | K  A      p.3680

          .         .         .         .         .         .       g.100317
 GGGGAGCAGGAGGAGGAGGAGGAAGAGGTGGAAGAGAAGAAGCCAGACCCCCTGCACCAG       c.11100
 G  E  Q  E  E  E  E  E  E  V  E  E  K  K  P  D  P  L  H  Q         p.3700

          .         .         .         .  | 77      .         .    g.103809
 TTGGTCCTGCACTTCAGCCGCACTGCCCTGACGGAAAAGAG | CAAACTGGATGAGGATTAC    c.11160
 L  V  L  H  F  S  R  T  A  L  T  E  K  S  |  K  L  D  E  D  Y      p.3720

          .         .         .    | 78    .         .         .    g.103998
 CTGTACATGGCCTATGCTGATATCATGGCAAAG | AGCTGCCACCTGGAGGAGGGAGGGGAG    c.11220
 L  Y  M  A  Y  A  D  I  M  A  K   | S  C  H  L  E  E  G  G  E      p.3740

          .         .         .          | 79        .         .    g.106041
 AACGGTGAAGCTGAAGAGGAGGTTGAGGTCTCCTTTGAG | GAGAAACAGATGGAGAAGCAG    c.11280
 N  G  E  A  E  E  E  V  E  V  S  F  E   | E  K  Q  M  E  K  Q      p.3760

          .         .         .         .         .         .       g.106101
 AGGCTCTTGTACCAGCAAGCACGGCTGCACACCCGGGGGGCGGCCGAGATGGTGCTGCAG       c.11340
 R  L  L  Y  Q  Q  A  R  L  H  T  R  G  A  A  E  M  V  L  Q         p.3780

          .          | 80        .         .         .         .    g.106482
 ATGATCAGTGCCTGCAAAG | GAGAGACAGGTGCCATGGTGTCCTCCACCCTGAAGCTGGGC    c.11400
 M  I  S  A  C  K  G |   E  T  G  A  M  V  S  S  T  L  K  L  G      p.3800

          .         .         .          | 81        .         .    g.106637
 ATCTCCATCCTCAATGGAGGCAATGCTGAGGTCCAGCAG | AAAATGCTGGATTATCTTAAG    c.11460
 I  S  I  L  N  G  G  N  A  E  V  Q  Q   | K  M  L  D  Y  L  K      p.3820

          .         .         .         .         .       | 82 .    g.107301
 GACAAGAAGGAAGTTGGCTTCTTCCAGAGTATCCAGGCACTGATGCAAACATGCAG | CGTC    c.11520
 D  K  K  E  V  G  F  F  Q  S  I  Q  A  L  M  Q  T  C  S  |  V      p.3840

          .         .         .         .         .         .       g.107361
 CTGGATCTCAATGCCTTTGAGAGACAGAACAAGGCCGAGGGGCTGGGCATGGTGAATGAG       c.11580
 L  D  L  N  A  F  E  R  Q  N  K  A  E  G  L  G  M  V  N  E         p.3860

          . | 83       .         | 84         .         .         . g.109212
 GATGGCACTG | TCATCAATCGCCAGAACG | GAGAGAAGGTCATGGCGGATGATGAATTCACA c.11640
 D  G  T  V |   I  N  R  Q  N  G |   E  K  V  M  A  D  D  E  F  T   p.3880

          .         .         .         .          | 85        .    g.114658
 CAAGACCTGTTCCGATTCCTACAATTGCTCTGTGAGGGGCACAATAATG | ATTTCCAGAAC    c.11700
 Q  D  L  F  R  F  L  Q  L  L  C  E  G  H  N  N  D |   F  Q  N      p.3900

          .         .         .         .         .         .       g.114718
 TACCTACGGACACAGACAGGGAACACGACCACTATTAACATCATCATTTGCACTGTGGAC       c.11760
 Y  L  R  T  Q  T  G  N  T  T  T  I  N  I  I  I  C  T  V  D         p.3920

          .         | 86         .         .         .         .    g.114874
 TACCTCCTGCGGCTGCAG | GAATCCATCAGCGACTTCTACTGGTACTACTCGGGCAAGGAT    c.11820
 Y  L  L  R  L  Q   | E  S  I  S  D  F  Y  W  Y  Y  S  G  K  D      p.3940

          .         .         .         .         .         .       g.114934
 GTCATTGAAGAGCAGGGCAAGAGGAACTTCTCCAAAGCCATGTCGGTGGCTAAGCAGGTG       c.11880
 V  I  E  E  Q  G  K  R  N  F  S  K  A  M  S  V  A  K  Q  V         p.3960

          .         .        | 87.         .         .         .    g.115104
 TTCAACAGCCTCACTGAGTACATCCAG | GGTCCCTGCACCGGGAACCAGCAGAGCCTGGCG    c.11940
 F  N  S  L  T  E  Y  I  Q   | G  P  C  T  G  N  Q  Q  S  L  A      p.3980

          .         .         .         .         .         .       g.115164
 CACAGTCGCCTATGGGACGCAGTGGTGGGATTCCTGCACGTGTTCGCCCACATGATGATG       c.12000
 H  S  R  L  W  D  A  V  V  G  F  L  H  V  F  A  H  M  M  M         p.4000

          .   | 88     .         .         .         .         .    g.117793
 AAGCTCGCTCAG | GACTCAAGCCAGATCGAGCTGCTGAAGGAGCTGCTGGATCTGCAGAAG    c.12060
 K  L  A  Q   | D  S  S  Q  I  E  L  L  K  E  L  L  D  L  Q  K      p.4020

          .         .         .     | 89   .         .         .    g.119559
 GACATGGTGGTGATGTTGCTGTCGCTACTAGAAG | GGAACGTGGTGAACGGCATGATCGCC    c.12120
 D  M  V  V  M  L  L  S  L  L  E  G |   N  V  V  N  G  M  I  A      p.4040

          .         .         .         .         .         .       g.119619
 CGGCAGATGGTGGACATGCTCGTGGAATCCTCATCCAATGTGGAGATGATCCTCAAGTTC       c.12180
 R  Q  M  V  D  M  L  V  E  S  S  S  N  V  E  M  I  L  K  F         p.4060

          .         .         .         .         .         .       g.119679
 TTCGACATGTTCCTGAAACTCAAGGACATTGTGGGCTCTGAAGCCTTCCAGGACTACGTA       c.12240
 F  D  M  F  L  K  L  K  D  I  V  G  S  E  A  F  Q  D  Y  V         p.4080

          .         .         .         .   | 90     .         .    g.132431
 ACGGATCCCCGTGGCCTCATCTCCAAGAAGGACTTCCAGAAG | GCCATGGACAGCCAGAAG    c.12300
 T  D  P  R  G  L  I  S  K  K  D  F  Q  K   | A  M  D  S  Q  K      p.4100

          .         .         .         .         .         .       g.132491
 CAGTTCAGCGGTCCAGAAATCCAGTTCCTGCTTTCGTGCTCCGAAGCGGATGAGAACGAA       c.12360
 Q  F  S  G  P  E  I  Q  F  L  L  S  C  S  E  A  D  E  N  E         p.4120

          .         .         .         .         .         .       g.132551
 ATGATCAACTGCGAAGAGTTCGCCAACCGCTTCCAGGAGCCAGCACGCGACATCGGCTTC       c.12420
 M  I  N  C  E  E  F  A  N  R  F  Q  E  P  A  R  D  I  G  F         p.4140

          .         .         .         .         .         .       g.132611
 AACGTGGCGGTGCTGCTGACCAACCTGTCGGAGCATGTGCCGCATGACCCTCGCCTGCAC       c.12480
 N  V  A  V  L  L  T  N  L  S  E  H  V  P  H  D  P  R  L  H         p.4160

          .         .         .         .         .         .       g.132671
 AACTTCCTGGAGCTGGCCGAGAGCATCCTTGAGTACTTCCGCCCCTACCTGGGCCGCATC       c.12540
 N  F  L  E  L  A  E  S  I  L  E  Y  F  R  P  Y  L  G  R  I         p.4180

          .         .         .         .         .         .       g.132731
 GAGATCATGGGCGCGTCACGCCGCATCGAGCGCATCTACTTCGAGATCTCAGAGACCAAC       c.12600
 E  I  M  G  A  S  R  R  I  E  R  I  Y  F  E  I  S  E  T  N         p.4200

          .         .     | 91   .         .         .         .    g.136295
 CGCGCCCAGTGGGAGATGCCCCAG | GTGAAGGAGTCCAAGCGCCAGTTCATCTTCGACGTG    c.12660
 R  A  Q  W  E  M  P  Q   | V  K  E  S  K  R  Q  F  I  F  D  V      p.4220

          .         .         .         .         .         .       g.136355
 GTGAACGAGGGCGGCGAGGCTGAGAAGATGGAGCTCTTCGTGAGTTTCTGCGAGGACACC       c.12720
 V  N  E  G  G  E  A  E  K  M  E  L  F  V  S  F  C  E  D  T         p.4240

          .         .         .         .         .         .       g.136415
 ATCTTCGAGATGCAGATCGCCGCGCAGATCTCGGAGCCCGAGGGCGAGCCGGAGACCGAC       c.12780
 I  F  E  M  Q  I  A  A  Q  I  S  E  P  E  G  E  P  E  T  D         p.4260

          .         .         .         .         .         .       g.136475
 GAGGACGAGGGCGCGGGCGCGGCGGAGGCGGGCGCGGAAGGCGCGGAGGAGGGCGCGGCG       c.12840
 E  D  E  G  A  G  A  A  E  A  G  A  E  G  A  E  E  G  A  A         p.4280

          .         .         .         .         .         .       g.136535
 GGGCTCGAGGGCACGGCGGCCACGGCGGCGGCGGGGGCGACGGCGCGGGTTGTGGCGGCC       c.12900
 G  L  E  G  T  A  A  T  A  A  A  G  A  T  A  R  V  V  A  A         p.4300

          .         .         .         .         .         .       g.136595
 GCAGGCCGGGCCCTGCGAGGCCTCAGCTACCGCAGCCTGCGGCGGCGCGTGCGGCGGCTG       c.12960
 A  G  R  A  L  R  G  L  S  Y  R  S  L  R  R  R  V  R  R  L         p.4320

          .         .         .         .         .         .       g.136655
 CGGCGGCTTACGGCCCGCGAGGCGGCCACCGCAGTGGCGGCGCTGCTCTGGGCAGCAGTG       c.13020
 R  R  L  T  A  R  E  A  A  T  A  V  A  A  L  L  W  A  A  V         p.4340

          .         .         .         .         .         .       g.136715
 ACGCGCGCTGGGGCCGCTGGCGCGGGGGCGGCGGCGGGCGCGCTGGGCCTGCTCTGGGGC       c.13080
 T  R  A  G  A  A  G  A  G  A  A  A  G  A  L  G  L  L  W  G         p.4360

          .         .         .         .         .         .       g.136775
 TCGCTGTTCGGCGGCGGCCTGGTGGAGGGCGCCAAGAAGGTGACGGTGACCGAGCTCCTG       c.13140
 S  L  F  G  G  G  L  V  E  G  A  K  K  V  T  V  T  E  L  L         p.4380

          .         .         .         .         .         .       g.136835
 GCAGGCATGCCCGACCCCACCAGCGACGAGGTGCACGGCGAGCAGCCGGCCGGGCCGGGC       c.13200
 A  G  M  P  D  P  T  S  D  E  V  H  G  E  Q  P  A  G  P  G         p.4400

          .         .         .         .         .         .       g.136895
 GGAGACGCAGACGGCGAGGGTGCCAGCGAGGGCGCTGGAGACGCCGCGGAGGGCGCTGGA       c.13260
 G  D  A  D  G  E  G  A  S  E  G  A  G  D  A  A  E  G  A  G         p.4420

          .         .         .         .         .         .       g.136955
 GACGAGGAGGAGGCGGTGCACGAGGCCGGGCCGGGCGGTGCCGACGGGGCGGTGGCCGTG       c.13320
 D  E  E  E  A  V  H  E  A  G  P  G  G  A  D  G  A  V  A  V         p.4440

          .         .         .         .         .         .       g.137015
 ACCGATGGGGGCCCCTTCCGGCCCGAAGGGGCTGGCGGTCTCGGGGACATGGGGGACACG       c.13380
 T  D  G  G  P  F  R  P  E  G  A  G  G  L  G  D  M  G  D  T         p.4460

          .         .         .         .         .        | 92.    g.138214
 ACGCCTGCGGAACCGCCCACACCCGAGGGCTCTCCCATCCTCAAGAGGAAATTGGGG | GTG    c.13440
 T  P  A  E  P  P  T  P  E  G  S  P  I  L  K  R  K  L  G   | V      p.4480

          .         .         .         .         .         .       g.138274
 GATGGAGTGGAGGAGGAGCTCCCGCCAGAGCCAGAGCCCGAGCCGGAACCAGAGCTGGAG       c.13500
 D  G  V  E  E  E  L  P  P  E  P  E  P  E  P  E  P  E  L  E         p.4500

          .     | 93   .         .         .         .         .    g.139119
 CCGGAGAAAGCCGA | TGCCGAGAATGGGGAGAAGGAAGAAGTTCCCGAGCCCACACCAGAG    c.13560
 P  E  K  A  D  |  A  E  N  G  E  K  E  E  V  P  E  P  T  P  E      p.4520

          .         .         .         .         .         .       g.139179
 CCCCCCAAGAAGCAAGCACCTCCCTCACCCCCTCCAAAGAAGGAGGAAGCTGGAGGCGAA       c.13620
 P  P  K  K  Q  A  P  P  S  P  P  P  K  K  E  E  A  G  G  E         p.4540

          .         .         .          | 94        .         .    g.141928
 TTCTGGGGAGAACTGGAGGTGCAGAGGGTGAAGTTCCTG | AACTACCTGTCCCGGAACTTT    c.13680
 F  W  G  E  L  E  V  Q  R  V  K  F  L   | N  Y  L  S  R  N  F      p.4560

          .         .         .         .         .         .       g.141988
 TACACCCTGCGGTTCCTTGCCCTCTTCTTGGCATTTGCCATCAACTTCATCTTGCTGTTT       c.13740
 Y  T  L  R  F  L  A  L  F  L  A  F  A  I  N  F  I  L  L  F         p.4580

        | 95 .         .         .         .         .         .    g.143373
 TATAAG | GTCTCAGACTCTCCACCAGGGGAGGACGACATGGAAGGCTCAGCTGCTGGGGAT    c.13800
 Y  K   | V  S  D  S  P  P  G  E  D  D  M  E  G  S  A  A  G  D      p.4600

          .         .         .         .         .         .       g.143433
 GTGTCAGGTGCAGGCTCTGGTGGCAGCTCTGGCTGGGGCTTGGGGGCCGGAGAGGAGGCA       c.13860
 V  S  G  A  G  S  G  G  S  S  G  W  G  L  G  A  G  E  E  A         p.4620

          .         .         .         .         .         .       g.143493
 GAGGGCGATGAGGATGAGAACATGGTGTACTACTTCCTGGAGGAAAGCACAGGCTACATG       c.13920
 E  G  D  E  D  E  N  M  V  Y  Y  F  L  E  E  S  T  G  Y  M         p.4640

          .         .         .         .         .         .       g.143553
 GAACCCGCCCTGCGGTGTCTGAGCCTCCTGCATACACTGGTGGCCTTTCTCTGCATCATT       c.13980
 E  P  A  L  R  C  L  S  L  L  H  T  L  V  A  F  L  C  I  I         p.4660

          .         | 96         .         .         .         .    g.144519
 GGCTATAATTGTCTCAAG | GTGCCCCTGGTAATCTTTAAGCGGGAGAAGGAGCTGGCCCGG    c.14040
 G  Y  N  C  L  K   | V  P  L  V  I  F  K  R  E  K  E  L  A  R      p.4680

          .         .         .         .         .         .       g.144579
 AAGCTGGAGTTTGATGGCCTGTACATCACGGAGCAGCCTGAGGACGATGACGTGAAGGGG       c.14100
 K  L  E  F  D  G  L  Y  I  T  E  Q  P  E  D  D  D  V  K  G         p.4700

          .         .          | 97        .         .         .    g.147250
 CAGTGGGACCGACTGGTGCTCAACACGCC | GTCTTTCCCTAGCAACTACTGGGACAAGTTT    c.14160
 Q  W  D  R  L  V  L  N  T  P  |  S  F  P  S  N  Y  W  D  K  F      p.4720

          .   | 98     .         .         .         .         .    g.149266
 GTCAAGCGCAAG | GTCCTGGACAAACATGGGGACATCTACGGGCGGGAGCGGATTGCTGAG    c.14220
 V  K  R  K   | V  L  D  K  H  G  D  I  Y  G  R  E  R  I  A  E      p.4740

          .         .         .         .         .         .       g.149326
 CTACTGGGCATGGACCTGGCCACACTAGAGATCACAGCCCACAATGAGCGCAAGCCCAAC       c.14280
 L  L  G  M  D  L  A  T  L  E  I  T  A  H  N  E  R  K  P  N         p.4760

          .         .    | 99    .         .         .         .    g.149481
 CCGCCGCCAGGGCTGCTGACCTG | GCTCATGTCCATCGATGTCAAGTACCAGATCTGGAAG    c.14340
 P  P  P  G  L  L  T  W  |  L  M  S  I  D  V  K  Y  Q  I  W  K      p.4780

          .         .     | 100  .         .         .         .    g.151318
 TTCGGGGTCATCTTCACAGACAAC | TCCTTCCTGTACCTGGGCTGGTATATGGTGATGTCC    c.14400
 F  G  V  I  F  T  D  N   | S  F  L  Y  L  G  W  Y  M  V  M  S      p.4800

          .         .         .         .         .         .       g.151378
 CTCTTGGGACACTACAACAACTTCTTCTTTGCTGCCCATCTCCTGGACATCGCCATGGGG       c.14460
 L  L  G  H  Y  N  N  F  F  F  A  A  H  L  L  D  I  A  M  G         p.4820

          .         .         .         .         .  | 101     .    g.151679
 GTCAAGACGCTGCGCACCATCCTGTCCTCTGTCACCCACAATGGGAAACAG | CTGGTGATG    c.14520
 V  K  T  L  R  T  I  L  S  S  V  T  H  N  G  K  Q   | L  V  M      p.4840

          .         .         .         .         .         .       g.151739
 ACCGTGGGCCTTCTGGCGGTGGTCGTCTACCTGTACACCGTGGTGGCCTTCAACTTCTTC       c.14580
 T  V  G  L  L  A  V  V  V  Y  L  Y  T  V  V  A  F  N  F  F         p.4860

          .         .         .         .         .         .       g.151799
 CGCAAGTTCTACAACAAGAGCGAGGATGAGGATGAACCTGACATGAAGTGTGATGACATG       c.14640
 R  K  F  Y  N  K  S  E  D  E  D  E  P  D  M  K  C  D  D  M         p.4880

        | 102.         .         .         .         .         .    g.156297
 ATGACG | TGTTACCTGTTTCACATGTACGTGGGTGTCCGGGCTGGCGGAGGCATTGGGGAC    c.14700
 M  T   | C  Y  L  F  H  M  Y  V  G  V  R  A  G  G  G  I  G  D      p.4900

          .         .         .         .         .         .       g.156357
 GAGATCGAGGACCCCGCGGGTGACGAATACGAGCTCTACAGGGTGGTCTTCGACATCACC       c.14760
 E  I  E  D  P  A  G  D  E  Y  E  L  Y  R  V  V  F  D  I  T         p.4920

          .         .         .         .    | 103   .         .    g.157255
 TTCTTCTTCTTCGTCATCGTCATCCTGTTGGCCATCATCCAGG | GTCTGATCATCGACGCT    c.14820
 F  F  F  F  V  I  V  I  L  L  A  I  I  Q  G |   L  I  I  D  A      p.4940

          .         .         .         .         | 104        .    g.157403
 TTTGGTGAGCTCCGAGACCAACAAGAGCAAGTGAAGGAGGATATGGAG | ACCAAGTGCTTC    c.14880
 F  G  E  L  R  D  Q  Q  E  Q  V  K  E  D  M  E   | T  K  C  F      p.4960

          .         .         .         .         .         .       g.157463
 ATCTGTGGAATCGGCAGTGACTACTTTGATACGACACCGCATGGCTTCGAGACTCACACG       c.14940
 I  C  G  I  G  S  D  Y  F  D  T  T  P  H  G  F  E  T  H  T         p.4980

          .         .          | 105       .         .         .    g.157856
 CTGGAGGAGCACAACCTGGCCAATTACAT | GTTTTTCCTGATGTATTTGATAAACAAGGAT    c.15000
 L  E  E  H  N  L  A  N  Y  M  |  F  F  L  M  Y  L  I  N  K  D      p.5000

          .         .  | 106     .         .         .         .    g.158664
 GAGACAGAACACACGGGTCAG | GAGTCTTATGTCTGGAAGATGTACCAAGAGAGATGTTGG    c.15060
 E  T  E  H  T  G  Q   | E  S  Y  V  W  K  M  Y  Q  E  R  C  W      p.5020

          .         .         .         .         .                 g.158721
 GATTTCTTCCCAGCTGGTGATTGTTTCCGTAAGCAGTATGAGGACCAGCTTAGCTGA          c.15117
 D  F  F  P  A  G  D  C  F  R  K  Q  Y  E  D  Q  L  S  X            p.5038

          .         .         .         .         .         .       g.158781
 cacacccccagctggccctccacccccacctcaagtgccttattctcacagcaagcccct       c.*60

          .         .         .         .         .         .       g.158841
 tagtccccaagcccctccccctaaggcagctgggggagaggtgacctagtactggaaaat       c.*120

          .         .                                               g.158865
 aaatctgtgctacgccccccagca                                           c.*144

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Ryanodine receptor 1 (skeletal) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 22
©2004-2019 Leiden University Medical Center