S100 calcium binding protein A1 (S100A1) - coding DNA reference sequence

(used for variant description)

(last modified March 14, 2014)

This file was created to facilitate the description of sequence variants on transcript NM_006271.1 in the S100A1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering S100A1 transcript NM_006271.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5053
        ggactgttgaagacaggtctccacacacagctccagcagccacatttgcaacc       c.-61

 .         .         .         .         .       | 02 .             g.7125
 ttggccatctgtccagaacctgctcccacctcaggcccaggccaacc | gtgcactgctgca    c.-1

          .         .         .         .         .         .       g.7185
 ATGGGCTCTGAGCTGGAGACGGCGATGGAGACCCTCATCAACGTGTTCCACGCCCACTCG       c.60
 M  G  S  E  L  E  T  A  M  E  T  L  I  N  V  F  H  A  H  S         p.20

          .         .         .         .         .         .       g.7245
 GGCAAAGAGGGGGACAAGTACAAGCTGAGCAAGAAGGAGCTGAAAGAGCTGCTGCAGACG       c.120
 G  K  E  G  D  K  Y  K  L  S  K  K  E  L  K  E  L  L  Q  T         p.40

          .         .  | 03      .         .         .         .    g.8340
 GAGCTCTCTGGCTTCCTGGAT | GCCCAGAAGGATGTGGATGCTGTGGACAAGGTGATGAAG    c.180
 E  L  S  G  F  L  D   | A  Q  K  D  V  D  A  V  D  K  V  M  K      p.60

          .         .         .         .         .         .       g.8400
 GAGCTAGACGAGAATGGAGACGGGGAGGTGGACTTCCAGGAGTATGTGGTGCTTGTGGCT       c.240
 E  L  D  E  N  G  D  G  E  V  D  F  Q  E  Y  V  V  L  V  A         p.80

          .         .         .         .                           g.8445
 GCTCTCACAGTGGCCTGTAACAATTTCTTCTGGGAGAACAGTTGA                      c.285
 A  L  T  V  A  C  N  N  F  F  W  E  N  S  X                        p.94

          .         .         .         .         .         .       g.8505
 gcagacagccacattgggcagcgcccttcctctccaccctcccagacctgcctcttcccc       c.*60

          .         .         .         .         .         .       g.8565
 ctgcttccacctcaccccacttatccctctccataaccccacccttgcccaccccacccc       c.*120

          .         .         .         .         .         .       g.8625
 cacccccaccaagggcgcaagagtagcggtccaagcctgcaactcatctttcattaaagg       c.*180

          .                                                         g.8640
 cttctctctcaccag                                                    c.*195

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The S100 calcium binding protein A1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.