sphingosine-1-phosphate receptor 2 (S1PR2) - coding DNA reference sequence

(used for variant description)

(last modified March 23, 2018)

This file was created to facilitate the description of sequence variants on transcript NM_004230.3 in the S1PR2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_046802.1, covering S1PR2 transcript NM_004230.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5586
          cggccgccctggggacgcagacgccaaggcccctccggccagggccgggag       c.-61

 .         .        | 02.         .         .         .             g.11902
 ccgggccggcctagccag | ttctgaaagccccatggccccagcaggcctctgagccccacc    c.-1

          .         .         .         .         .         .       g.11962
 ATGGGCAGCTTGTACTCGGAGTACCTGAACCCCAACAAGGTCCAGGAACACTATAATTAT       c.60
 M  G  S  L  Y  S  E  Y  L  N  P  N  K  V  Q  E  H  Y  N  Y         p.20

          .         .         .         .         .         .       g.12022
 ACCAAGGAGACGCTGGAAACGCAGGAGACGACCTCCCGCCAGGTGGCCTCGGCCTTCATC       c.120
 T  K  E  T  L  E  T  Q  E  T  T  S  R  Q  V  A  S  A  F  I         p.40

          .         .         .         .         .         .       g.12082
 GTCATCCTCTGTTGCGCCATTGTGGTGGAAAACCTTCTGGTGCTCATTGCGGTGGCCCGA       c.180
 V  I  L  C  C  A  I  V  V  E  N  L  L  V  L  I  A  V  A  R         p.60

          .         .         .         .         .         .       g.12142
 AACAGCAAGTTCCACTCGGCAATGTACCTGTTTCTGGGCAACCTGGCCGCCTCCGATCTA       c.240
 N  S  K  F  H  S  A  M  Y  L  F  L  G  N  L  A  A  S  D  L         p.80

          .         .         .         .         .         .       g.12202
 CTGGCAGGCGTGGCCTTCGTAGCCAATACCTTGCTCTCTGGCTCTGTCACGCTGAGGCTG       c.300
 L  A  G  V  A  F  V  A  N  T  L  L  S  G  S  V  T  L  R  L         p.100

          .         .         .         .         .         .       g.12262
 ACGCCTGTGCAGTGGTTTGCCCGGGAGGGCTCTGCCTTCATCACGCTCTCGGCCTCTGTC       c.360
 T  P  V  Q  W  F  A  R  E  G  S  A  F  I  T  L  S  A  S  V         p.120

          .         .         .         .         .         .       g.12322
 TTCAGCCTCCTGGCCATCGCCATTGAGCGCCACGTGGCCATTGCCAAGGTCAAGCTGTAT       c.420
 F  S  L  L  A  I  A  I  E  R  H  V  A  I  A  K  V  K  L  Y         p.140

          .         .         .         .         .         .       g.12382
 GGCAGCGACAAGAGCTGCCGCATGCTTCTGCTCATCGGGGCCTCGTGGCTCATCTCGCTG       c.480
 G  S  D  K  S  C  R  M  L  L  L  I  G  A  S  W  L  I  S  L         p.160

          .         .         .         .         .         .       g.12442
 GTCCTCGGTGGCCTGCCCATCCTTGGCTGGAACTGCCTGGGCCACCTCGAGGCCTGCTCC       c.540
 V  L  G  G  L  P  I  L  G  W  N  C  L  G  H  L  E  A  C  S         p.180

          .         .         .         .         .         .       g.12502
 ACTGTCCTGCCTCTCTACGCCAAGCATTATGTGCTGTGCGTGGTGACCATCTTCTCCATC       c.600
 T  V  L  P  L  Y  A  K  H  Y  V  L  C  V  V  T  I  F  S  I         p.200

          .         .         .         .         .         .       g.12562
 ATCCTGTTGGCCATCGTGGCCCTGTACGTGCGCATCTACTGCGTGGTCCGCTCAAGCCAC       c.660
 I  L  L  A  I  V  A  L  Y  V  R  I  Y  C  V  V  R  S  S  H         p.220

          .         .         .         .         .         .       g.12622
 GCTGACATGGCCGCCCCGCAGACGCTAGCCCTGCTCAAGACGGTCACCATCGTGCTAGGC       c.720
 A  D  M  A  A  P  Q  T  L  A  L  L  K  T  V  T  I  V  L  G         p.240

          .         .         .         .         .         .       g.12682
 GTCTTTATCGTCTGCTGGCTGCCCGCCTTCAGCATCCTCCTTCTGGACTATGCCTGTCCC       c.780
 V  F  I  V  C  W  L  P  A  F  S  I  L  L  L  D  Y  A  C  P         p.260

          .         .         .         .         .         .       g.12742
 GTCCACTCCTGCCCGATCCTCTACAAAGCCCACTACTTTTTCGCCGTCTCCACCCTGAAT       c.840
 V  H  S  C  P  I  L  Y  K  A  H  Y  F  F  A  V  S  T  L  N         p.280

          .         .         .         .         .         .       g.12802
 TCCCTGCTCAACCCCGTCATCTACACGTGGCGCAGCCGGGACCTGCGGCGGGAGGTGCTT       c.900
 S  L  L  N  P  V  I  Y  T  W  R  S  R  D  L  R  R  E  V  L         p.300

          .         .         .         .         .         .       g.12862
 CGGCCGCTGCAGTGCTGGAGGCCGGGGGTGGGGGTGCAAGGACGGAGGCGGGGCGGGACC       c.960
 R  P  L  Q  C  W  R  P  G  V  G  V  Q  G  R  R  R  G  G  T         p.320

          .         .         .         .         .         .       g.12922
 CCGGGCCACCACCTCCTGCCACTCCGCAGCTCCAGCTCCCTGGAGAGGGGCATGCACATG       c.1020
 P  G  H  H  L  L  P  L  R  S  S  S  S  L  E  R  G  M  H  M         p.340

          .         .         .         .                           g.12964
 CCCACGTCACCCACGTTTCTGGAGGGCAACACGGTGGTCTGA                         c.1062
 P  T  S  P  T  F  L  E  G  N  T  V  V  X                           p.353

          .         .         .         .         .         .       g.13024
 gggtgggggtggaccaacaaccaggccagggcagaggggttcatggagaggccactgggt       c.*60

          .         .         .         .         .         .       g.13084
 gaccccagatagagacttggggctactgagccagatgcccccgccccacagacctgggtg       c.*120

          .         .         .         .         .         .       g.13144
 atgttgcaaatatttcacacctggaaaggccagataaggcactgactagtcacatagcag       c.*180

          .         .         .         .         .         .       g.13204
 tgttgcagtgcggtcctgagggccagtccagtggctagtgtgacccctttagaactggat       c.*240

          .         .         .         .         .         .       g.13264
 cctggggaggccagggcaggggacctgtgaagagccagggtgagggcaggcagcatttaa       c.*300

          .         .         .         .         .         .       g.13324
 ggggagctcagggcaggagcactttaccacctggtacaaaggatttttttttttttttga       c.*360

          .         .         .         .         .         .       g.13384
 gacggaatcttgcactgctgcccaggctggagtgcagtggcgtgatctcggctcaccgca       c.*420

          .         .         .         .         .         .       g.13444
 agctccgcctcctgggttcatgtcgttctcctgcctcagcctcccaagtagctgggacta       c.*480

          .         .         .         .         .         .       g.13504
 taggcgcctgccaccacacctggctaattttttgtacctttagtagagatggggtttcac       c.*540

          .         .         .         .         .         .       g.13564
 cgtgttagccaggatggtcttgatctcctgacctcgtgatccgcccgcctcggcctccca       c.*600

          .         .         .         .         .         .       g.13624
 aagtgctgggattacaggcgtgagccaccgtgcccggctttttttttttttttttttttt       c.*660

          .         .         .         .         .         .       g.13684
 tttttttttttttttgagatgaagtctcgctctgttgcccaggctggagagtgcagtggt       c.*720

          .         .         .         .         .         .       g.13744
 acggtctcagctcactgcaacctccacctcccaggttcaagcgattctccagcctgagcc       c.*780

          .         .         .         .         .         .       g.13804
 tcctgagtagctgggattacaggtgcctaccaccacgcccaggtaatttttttttttttt       c.*840

          .         .         .         .         .         .       g.13864
 gtatttttagtagagacggggtttcaccatgttggccaggctggtctcgaactcctgacc       c.*900

          .         .         .         .         .         .       g.13924
 tcatgatccgcccgtgttggcctcccaaagtgtgggattacaggcgtaagccacctcacc       c.*960

          .         .         .         .         .         .       g.13984
 tggcggtacaaagaatttctgcattttcttccctggcccctagtcctgcaccgatttctc       c.*1020

          .         .         .         .         .         .       g.14044
 cttttcgaatgtattcctcctgccaccttctctgggcaacttcgtgcgactacagaacca       c.*1080

          .         .         .         .         .         .       g.14104
 ctgtcctgaggagctagaggcctcctctctgaccatccagagcccaaatccacagcttcc       c.*1140

          .         .         .         .         .         .       g.14164
 ccaaatttcatcagctgccacttgacgacttctccccgtctctctgaggcccggaaacca       c.*1200

          .         .         .         .         .         .       g.14224
 cggctggaggtggggaggggatggcggctgaggtccattcctcattctcagacctcattg       c.*1260

          .         .         .         .         .         .       g.14284
 ctcagttgcactatttggggcacagaataatcaccaaaagtgagaaaaacgagtttgggt       c.*1320

          .         .         .         .         .         .       g.14344
 ggctggggaggactttgggactcttgatgcaaggcgcaacttgagaaaattctgggtgtg       c.*1380

          .         .         .         .         .         .       g.14404
 atatttgcacagacaccctcctttcaaaaacagccaccccccaagctattctcagctcca       c.*1440

          .         .         .         .         .         .       g.14464
 cacctgcagccccagctaaggtaccaggtctcctgagcaaggcagagagaagccttgagc       c.*1500

          .         .         .         .         .         .       g.14524
 cttctctgtgtcttctttcaagaaccccgctgtgtcttctttcaagattttttttttgag       c.*1560

          .         .         .         .         .         .       g.14584
 acagtttcaagatttttgttttgtttttgagatggagtctcactgtgtcacccaggctga       c.*1620

          .         .         .         .         .         .       g.14644
 ggtggcagtggttcaatctccgttcactgccacctccacctcccgggttcaagcgattct       c.*1680

          .         .         .         .         .         .       g.14704
 cctgcttcagcctctcgagtagctgggactacaggcacctgccaccatgtctggctaatt       c.*1740

          .         .         .         .         .         .       g.14764
 tttgtatttttagtagagacagggtttcactacgttggccaggctggtctcaaactcctg       c.*1800

          .         .         .         .         .         .       g.14824
 acctcaagtgatccgcccgcctcggcctccccaattgctgggattacaggcgtgagccac       c.*1860

          .         .         .         .         .         .       g.14884
 tgtgcccggccttcttctttcaagttatatagaatggagcatgggggtggcagtggctag       c.*1920

          .         .         .         .         .         .       g.14944
 ggacatttcctggggacactctcccctaaccccccagaaggacttcacaaaaacctgtgg       c.*1980

          .         .         .         .         .         .       g.15004
 ataatggaagggatgttacggtacaaacgtatatttatgtgtgtgtgtgtgtatgtgtgt       c.*2040

          .         .         .         .         .         .       g.15064
 gcgcgcgcgcgtgtgcacataggcgtgatgtctgtgaccctcctctcctcgtcacatttc       c.*2100

          .         .         .         .         .         .       g.15124
 ccccagaatgaatgctgtcctgtctgctcatgtttgtgttgaagctgccaaagtcgggga       c.*2160

          .         .         .         .         .         .       g.15184
 gctctggtcctgcccagacccctttggaattgctggcccatcctcccactggagagctgg       c.*2220

          .         .         .         .         .         .       g.15244
 ggtgcagctcaccttggggaaggaaacctcatgcctcagagtaatttcttgtgaatgcaa       c.*2280

          .         .         .         .         .         .       g.15304
 agcctgggggagcgggtctttggggggcaaggagccagtcaggggcttgtttcccctcat       c.*2340

          .         .         .         .         .         .       g.15364
 agagctccccagacgtgcctccgcaatgcctgaaacccagacctaggctaataaacggtt       c.*2400

          .                                                         g.15375
 caatttctgtt                                                        c.*2411

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Sphingosine-1-phosphate receptor 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.