serum amyloid A1 (SAA1) - coding DNA reference sequence

(used for variant description)

(last modified January 9, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_199161.3 in the SAA1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_021330.1, covering SAA1 transcript NM_199161.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .      | 02      g.5627
                     ggcagggacccgcagctcagctacagcacagatcag | cacc    c.-1

          .         .         .         .         .         .       g.5687
 ATGAAGCTTCTCACGGGCCTGGTTTTCTGCTCCTTGGTCCTGGGTGTCAGCAGCCGAAGC       c.60
 M  K  L  L  T  G  L  V  F  C  S  L  V  L  G  V  S  S  R  S         p.20

          .         .         .  | 03      .         .         .    g.7963
 TTCTTTTCGTTCCTTGGCGAGGCTTTTGATG | GGGCTCGGGACATGTGGAGAGCCTACTCT    c.120
 F  F  S  F  L  G  E  A  F  D  G |   A  R  D  M  W  R  A  Y  S      p.40

          .         .         .         .         .         .       g.8023
 GACATGAGAGAAGCCAATTACATCGGCTCAGACAAATACTTCCATGCTCGGGGGAACTAT       c.180
 D  M  R  E  A  N  Y  I  G  S  D  K  Y  F  H  A  R  G  N  Y         p.60

          .         .         .         .         . | 04       .    g.8466
 GATGCTGCCAAAAGGGGACCTGGGGGTGCCTGGGCTGCAGAAGTGATCAC | CGATGCCAGA    c.240
 D  A  A  K  R  G  P  G  G  A  W  A  A  E  V  I  T  |  D  A  R      p.80

          .         .         .         .         .         .       g.8526
 GAGAATATCCAGAGATTCTTTGGCCATGGTGCGGAGGACTCGCTGGCTGATCAGGCTGCC       c.300
 E  N  I  Q  R  F  F  G  H  G  A  E  D  S  L  A  D  Q  A  A         p.100

          .         .         .         .         .         .       g.8586
 AATGAATGGGGCAGGAGTGGCAAAGACCCCAATCACTTCCGACCTGCTGGCCTGCCTGAG       c.360
 N  E  W  G  R  S  G  K  D  P  N  H  F  R  P  A  G  L  P  E         p.120

                                                                    g.8595
 AAATACTGA                                                          c.369
 K  Y  X                                                            p.122

          .         .         .         .         .         .       g.8655
 gcttcctcttcactctgctctcaggagatctggctgtgaggccctcagggcagggataca       c.*60

          .         .         .         .         .         .       g.8715
 aagcggggagagggtacacaatgggtatctaataaatacttaagaggtggaatttgtgga       c.*120

                                                                    g.8717
 aa                                                                 c.*122

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Serum amyloid A1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 14c
©2004-2016 Leiden University Medical Center