sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 98 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .           g.5399
gtctgggcctgggaaggcttcctctgtctgtctgccatccatccatctg  c.273+49

--------------------- middle of intron ---------------------
 g.5400             .         .         .         .           g.5448
 c.274-49  tctgcctgtctgtctgtccctgggtctcacagcctctctcccaccttag  c.274-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center