sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 126 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5627
atatcctgcccaagatgggagaggcgggaggggttagggatgggcgagatggggtgctgt  c.392+60

     g.5630
ggc  c.392+63

--------------------- middle of intron ---------------------
                                               g.5631         g.5633
                                               c.393-63  cca  c.393-61

.         .         .         .         .         .           g.5693
ggagaccctctatcacctcccatcctagctgcttcctcactttccttgaccctgccccac  c.393-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center