sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 285 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5843
gtaagtctccctgctccctgagctccccagccctgggacacagcccatctcaggtgtttg  c.482+60

         .         .         .         .         .         .  g.5903
cacctctgtgtggtgctgctcttgtctttcagggagacacactgtcattgtgaccctcat  c.482+120

         .         .     g.5926
ccacaccttgagtccctggggtg  c.482+143

--------------------- middle of intron ---------------------
                           g.5927       .         .           g.5948
                           c.483-142  gccatgctatcactcgctagtg  c.483-121

.         .         .         .         .         .           g.6008
tccttagccacctgagtggcatatttcatttctgtgtccctcccttctgggggtctgtcg  c.483-61

.         .         .         .         .         .           g.6068
ttgccacactgacccctacccaggtgacatgcctgtcccggccggccctctcccccccag  c.483-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center