sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 468 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.6257
gtgagcaggggccccaggacatcctgaggctggggtgggtgaggggagggggccaggcct  c.611+60

         .         .         .         .         .         .  g.6317
taaagagggaagctgcctgggctgagggctgcaggggacatcggtcagttgtgcagatgg  c.611+120

         .         .         .         .         .         .  g.6377
ggagctgcacaattctagaagctgccattctcagggtctggctcagcactctcctgatgg  c.611+180

         .         .         .         .         .      g.6431
actcctgataatcacatgaggcagccctgacccacagacccatgggtcctcacc  c.611+234

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.6485
      tgctgggtgagccgggctatctttgccatccccactcccccagagctcctgcac  c.612-181

.         .         .         .         .         .           g.6545
tgtccttcccaacccttgggctcccagaggagctttgggggtgtctgccctgccccccag  c.612-121

.         .         .         .         .         .           g.6605
accctgtggtacccccaatttcttgggaatcctcatcccaggcctggaggagccctgatt  c.612-61

.         .         .         .         .         .           g.6665
tctgtcctaccacccaccccaggctctgacagtccccacccccctccaccccctacccag  c.612-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center