sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 2806 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.6817
gtactggggaggtgcagggaccctctgcctgagctgagagacccccgtaccatgtgcagg  c.703+60

         .         .         .         .         .         .  g.6877
cctggaacctgactcagtgtcacaacactcccaggctggtgtttttgtagaactcacagc  c.703+120

         .         .         .         .         .         .  g.6937
aaagcctggacatacaggggcccacgtgaccagagggcagatggggtcctacatggaagg  c.703+180

         .         .         .         .         .         .  g.6997
atgggcgtttgagaggcagcatggcaagttggttaagagcacagactcagctgggcatgg  c.703+240

         .         .         .         .         .         .  g.7057
tggctcacgcctataatcccagcactttgggaggccaaggcaagtggatcaactaaggtc  c.703+300

         .         .         .         .         .         .  g.7117
aggagtttgagaccagcctggccaacaagacaaaaccctgtctctactaaaaatacaaaa  c.703+360

         .         .         .         .         .         .  g.7177
attagcctggcatggtggtgtgcacctgtagtcccatctactcaggaggctgaggcagga  c.703+420

         .         .         .         .         .         .  g.7237
gaatcacttgaacctgggaaacagaggtggcagtcagccgagatcacgccactgcactcc  c.703+480

         .         .         .         .         .         .  g.7297
agcctaggcaacacagtgagattccatctcaaaaaaaaaaaagaaaacaaattagctggg  c.703+540

         .         .         .         .         .         .  g.7357
cctggttatgctctcctatagtcccagctacttgggaggctaaggcgggaggatagtttg  c.703+600

         .         .         .         .         .         .  g.7417
agcccaggagatcaagcctgctatgagctgtaattttgccactgcactccagcctgggaa  c.703+660

         .         .         .         .         .         .  g.7477
aaagaacaagactctgtctcaaaagaaaaaagcacagattctggagcctgactgcctggg  c.703+720

         .         .         .         .         .         .  g.7537
ttcaattctcacctttaccacttcctaactttaactttgggcaagtgcctcgccctgtcc  c.703+780

         .         .         .         .         .         .  g.7597
atgtctcagtttccttatctgtggcatatggagactcatagtaccactccttggattgtt  c.703+840

         .         .         .         .         .         .  g.7657
gtaaggattaaatgccttaatatctgtaaggccctcacagcccctggcccatggtttgtg  c.703+900

         .         .         .         .         .         .  g.7717
atatacacgtgtgtgctcaataaaataagcagacagagcagagaagagagagacacaaaa  c.703+960

         .         .         .         .         .         .  g.7777
aggctccatgaggaaaagtccaagctctgagagctcaattaggaacacaccaggcacctg  c.703+1020

         .         .         .         .         .         .  g.7837
ctgagcaataaggtcagagcaattccaaagtaatgcatcaacaagcatgaaatcaataga  c.703+1080

         .         .         .         .         .         .  g.7897
atccgaacattcagacctgcaaaagagcatgtggagaaactggagattctctcccagtaa  c.703+1140

         .         .         .         .         .         .  g.7957
aggagagaaagaaaaaggatagagatcaggctctgggaagagggaaaattgttaaatcct  c.703+1200

         .         .         .         .         .         .  g.8017
aatatgagaaagtacctgaggccaggtgtggtggcccatacctgtaatcccagcactttg  c.703+1260

         .         .         .         .         .         .  g.8077
ggaggccgagacaggtgaatcacttggggtcaggactctgagaccagcctggccaacgtg  c.703+1320

         .         .         .         .         .         .  g.8137
gtgaaaccccgtctctactcaaaatacaaaaattagctgggcgtggtggcatgtgcctgt  c.703+1380

         .         .     g.8160
aatcccagctacctgggaggctg  c.703+1403

--------------------- middle of intron ---------------------
                         g.8161         .         .           g.8183
                         c.704-1403  agcaggagaatcacttgaatcga  c.704-1381

.         .         .         .         .         .           g.8243
ggaggcagaagttgcagtgagccgagatcacaccactgcactccagcctgggcgacagag  c.704-1321

.         .         .         .         .         .           g.8303
cgagactctatctcaaaaaaaaaagaaaagaaaagaaaagaaagtaagaaagaaagtacc  c.704-1261

.         .         .         .         .         .           g.8363
tgagctatcttctagtctaaagccctctgactgcagccgaggaaggtgtgagacccagga  c.704-1201

.         .         .         .         .         .           g.8423
gaggaagcacttcccaaattccacactgtacattggccactgagccaagacggcattgcc  c.704-1141

.         .         .         .         .         .           g.8483
tttcctctgtgccagctgccagcatcctcggggcgcaggagggcttttataaggaggctg  c.704-1081

.         .         .         .         .         .           g.8543
ccgagcatttgttttccatatcaggataagaaaaggaaatgaagtcatattaacgcaaga  c.704-1021

.         .         .         .         .         .           g.8603
ggcactacgattaggcccaaggaagaagttacggctcttccacaggtgatgggaacctgc  c.704-961

.         .         .         .         .         .           g.8663
ccctgggattatttcagcatcgtttatgcctttgtctgtctaaagaatataatgatgttt  c.704-901

.         .         .         .         .         .           g.8723
caagttcagtctagagcttctgctgttcctcgggtgctactaggcattttaaggaaaagg  c.704-841

.         .         .         .         .         .           g.8783
gttctgtggtcaaatatgttaaggatacgtgggattaaagtttttgtttaataggccagg  c.704-781

.         .         .         .         .         .           g.8843
tgaggtggctcatgcctgtaatcccagcattttgggaggctgaggcaggctgattacttg  c.704-721

.         .         .         .         .         .           g.8903
aggccaggagttcgagaccagcctgtccaacatagcgaaacctcatccctactaaaagta  c.704-661

.         .         .         .         .         .           g.8963
ccaaaaaaatgagctgggtgtggtggcatgcacctgtaatcccagctacttgggaggctg  c.704-601

.         .         .         .         .         .           g.9023
aggcaggagaatcacttgaacccaggaggcagaggttgcagtgagccaagatcacgccac  c.704-541

.         .         .         .         .         .           g.9083
tgcattccagcctgggtgacagaatgagactctctctaaataaatacataaatacaaata  c.704-481

.         .         .         .         .         .           g.9143
aagtttttgtttatttctgcaggacttttcaaagcctttgataggatcaactacataatg  c.704-421

.         .         .         .         .         .           g.9203
actctccaagagcagaatctagaacgcagcttttcccaaacattatcaacgccccctttt  c.704-361

.         .         .         .         .         .           g.9263
taagggcacagcatgggagattagcgttctgttgaacacactttgacagcgctaacttag  c.704-301

.         .         .         .         .         .           g.9323
tgacatgtattaagctctgctgtatgcctttgtttgctctataggtcaggcaacagccca  c.704-241

.         .         .         .         .         .           g.9383
tcaggtctttatagttcattctcctagtggctgagcgtctgtggccatttgagggctcca  c.704-181

.         .         .         .         .         .           g.9443
gattgaggatgtgaacagagaagggtggagttaatttcagaaggcttcggggaagtagtg  c.704-121

.         .         .         .         .         .           g.9503
gtgctcagtaagtcaagccttgaagatggagtaggaaaaagcttggcggtgggggccgcg  c.704-61

.         .         .         .         .         .           g.9563
ggggctctgttatcaccctgccctgccccctgccaatatccttgccctctctgcggtcag  c.704-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center