sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 1478 nt intron 06 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.9956
gtaagaatggggagggtgacgggcaagggggatcctgtcccagtccctagggtagcctct  c.1036+60

         .         .         .         .         .         .  g.10016
gactccacattttctttttttttttttttgagatggagtctcactcttgtcacccaggct  c.1036+120

         .         .         .         .         .         .  g.10076
ggagtgcaaaggtgccatctcagctcactacaacctccgcctcccggcttcaagcgattc  c.1036+180

         .         .         .         .         .         .  g.10136
tcctgcctcagcctcccgagtagctaggattacaggcatgtgccaccaggcccaattaat  c.1036+240

         .         .         .         .         .         .  g.10196
ttttgtatttttagtaaagatagggttacatcatgttggccaggctggtctcgaactcct  c.1036+300

         .         .         .         .         .         .  g.10256
gacctcatgtgatcttcccacctcggcctcctaaagtgctgggattacaggcgtgagcca  c.1036+360

         .         .         .         .         .         .  g.10316
ccgctccccgccctgtctccacttcttatgagacaaatagtatggcgaggacctgagctt  c.1036+420

         .         .         .         .         .         .  g.10376
aaagctagcacttggcagcctgtgtcacctctgactagtcacttgatctccccagccctc  c.1036+480

         .         .         .         .         .         .  g.10436
cgaatcctcacctataaaatcaagataacaataccttcctcaaagggttactgcagcaac  c.1036+540

         .         .         .         .         .         .  g.10496
aaatggcaaactgttttaaaaaccctaaagtgccaggcacggtggctcacgcctgtaatc  c.1036+600

         .         .         .         .         .         .  g.10556
ccagcactttgggagggcgaggcaggcagatcacctgaggtcaggagttccagaccagcc  c.1036+660

         .         .         .         .         .         .  g.10616
tgaccaacgtggtgaaaccccgtctctaccaaaaatacaaaaattagccgggcgtggtga  c.1036+720

         .           g.10635
cgcatgcctgtaatcccag  c.1036+739

--------------------- middle of intron ---------------------
                             g.10636              .           g.10654
                             c.1037-739  ctactccagaggctgaggc  c.1037-721

.         .         .         .         .         .           g.10714
aggagaatcgcttgaacctggcagacagaggttgcagtgaaccgagatcatgccattaca  c.1037-661

.         .         .         .         .         .           g.10774
ctctagcctgggcaacaagagtgaaactcagtctaaaaaaaaaaaaatcctaaagctctc  c.1037-601

.         .         .         .         .         .           g.10834
actatgcaaagcaagagtctatagttcctactccctaacctgtgcaccccctgtcctcct  c.1037-541

.         .         .         .         .         .           g.10894
tcatcacaccacattttcacatgctcacatcctggcagggtcaccatcacccacccacac  c.1037-481

.         .         .         .         .         .           g.10954
acccacatcctattcacatatgcatcttcacaggcacacatgccagaaacacacacattc  c.1037-421

.         .         .         .         .         .           g.11014
tcacacagccactgttagtctacatagcgccttcttgcaaattaggaaaaggtaaccctt  c.1037-361

.         .         .         .         .         .           g.11074
ctcaccctggcacctggattccagcccccactcacccttcactcaggggccctacatagg  c.1037-301

.         .         .         .         .         .           g.11134
tacacaataaccccatgcacacacgtacacgttccgtctctgtgccactgctgcgtcatg  c.1037-241

.         .         .         .         .         .           g.11194
acttttcgtccacactgggcactgggctgacagggctcaagctgagctccctgccgagtc  c.1037-181

.         .         .         .         .         .           g.11254
cctacccagagaccttggaacttggagctgtccttaaaggacggggaagaggcagccagg  c.1037-121

.         .         .         .         .         .           g.11314
gaacatccgtttggtttatgtggtacgcgcagacctgtccacaggtgtgcaatgggcgca  c.1037-61

.         .         .         .         .         .           g.11374
ggtgctcacactgtgtccatgtgggtgacttgcctcctttgtggcctctgactcccaaag  c.1037-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center