sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 237 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.11498
gtgagtgatgctaagggatgcagaaaaggcaccccaggggtcttggaaggtgggagctga  c.1100+60

         .         .         .         .         .           g.11557
ttagagatgaggacctggggggcatgggagtgcagggaaacctgtgggcatggatggaa  c.1100+119

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.11615
  tacttttctgtttgggggacacaggcagaactgacggaatttttcccttggggtccct  c.1101-61

.         .         .         .         .         .           g.11675
atctgcccccagctggagtgctcctcccaccctaaacccagccccctgtcctattcctag  c.1101-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center