sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 1424 nt intron 08 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.11877
gtacagctgcccccaccctgccccccaaccctacagccactccccctccatccctgcagc  c.1242+60

         .         .         .         .         .         .  g.11937
ctcttcagggcctgatggggcctaccacaggatggccaacccccgaactgggccatctcc  c.1242+120

         .         .         .         .         .         .  g.11997
tcatggactcccgcagtgcccttataggagcttgtgctctctgaaactagacacctgccc  c.1242+180

         .         .         .         .         .         .  g.12057
cgagccaagccacagctttaattctttccacacctttgctttcagagccaaggtctggac  c.1242+240

         .         .         .         .         .         .  g.12117
ctagcataggcacaagcccaggaccccctaggcctcatgatagccagtagggcagcttag  c.1242+300

         .         .         .         .         .         .  g.12177
aaatccaatgctgcctgccgggcgcggtggctcacgcctgaaatcccagcactttgggag  c.1242+360

         .         .         .         .         .         .  g.12237
gcagaggtgggcggatcacgaggtcaggagttcgagaccagcctggccaacatagtgaaa  c.1242+420

         .         .         .         .         .         .  g.12297
ccccatctctactaaaaatacaaaaattagccgggtatggtggcacgggcctatattccc  c.1242+480

         .         .         .         .         .         .  g.12357
agctactcaggaggctgaggagggagaattgcttgaacccgggaggcggaggtggcagtg  c.1242+540

         .         .         .         .         .         .  g.12417
agccgagaccacgccattgcactccagcctgggcgacagagcgagactccgtctgaaaaa  c.1242+600

         .         .         .         .         .         .  g.12477
aaagaaagacagaaattcgatgttgcccatactttatttgccttctactgtttgcaggga  c.1242+660

         .         .         .         .         .    g.12529
aggcaggctgagcctggagtgacagtgccttctgatgccatgtgatgtttct  c.1242+712

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.12581
        aacattgatggtgttgataacaataacaaaaataataacagctactggctgg  c.1243-661

.         .         .         .         .         .           g.12641
gtgcagtggctcatgcctataatcctagcactatgggaggccgaggcaggcagatcactt  c.1243-601

.         .         .         .         .         .           g.12701
gaggtcagaagtttgagaccagcctggccagcatggcgaaacccatctctacaaaaaata  c.1243-541

.         .         .         .         .         .           g.12761
caaaaattagccaggtttggtggcaaacacctgtaatcccagctactcaggagactgagg  c.1243-481

.         .         .         .         .         .           g.12821
aaggagaatcacttcaacctgggaggtggaggttgcagtgagccgagatcacaccgctgc  c.1243-421

.         .         .         .         .         .           g.12881
actccagcctgggcaacagagtgagactacgtctaaaaataaataaataaattgattaaa  c.1243-361

.         .         .         .         .         .           g.12941
taataataatagctactatttgttgagttcttactaggtgccaggcactgtggcaaagct  c.1243-301

.         .         .         .         .         .           g.13001
agaattcaagctgaccccaaacccatgttcaccaattttctatcctggctctctgataac  c.1243-241

.         .         .         .         .         .           g.13061
aggatgcctggcttcggtcctcctctgagccaggagaccagaaacgtttgagtcccaagt  c.1243-181

.         .         .         .         .         .           g.13121
agatattttgaagttccccagaacatggctcagcatgccaatgacggccatcagtccccc  c.1243-121

.         .         .         .         .         .           g.13181
aggctctgtgagggaggggctctgcttacccatgcgggcaatggatgtatggaaaggggc  c.1243-61

.         .         .         .         .         .           g.13241
actgggtcaaaggaggtggacgtcatgggacccctccactccctctccctccactcccag  c.1243-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center