sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) - 642 nt intron 09 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.13511
gtctggactcagggaaaggagatagaggacccagggttctacctgccctcagccggggct  c.1452+60

         .         .         .         .         .         .  g.13571
gccactggcttctccctggggggccgagggtgagggagggtacaggggtaggggttttga  c.1452+120

         .         .         .         .         .         .  g.13631
ggcagaaggagcagaaggccctgggctgggagctttgctggtggcagggggatggaggga  c.1452+180

         .         .         .         .         .         .  g.13691
tccaagcagtagaaaaagcatttctctgctctgtgcctcagtttccctgtctataacaag  c.1452+240

         .         .         .         .         .         .  g.13751
gaatctggagtagctaaacctgaagtattcttccagctcaaatatttctgattttgtgat  c.1452+300

         .         .   g.13772
gctttctgggtagtggatagg  c.1452+321

--------------------- middle of intron ---------------------
                           g.13773      .         .           g.13793
                           c.1453-321  tccatactgagggaagggcag  c.1453-301

.         .         .         .         .         .           g.13853
gtcctgatgaggccacagggagcggctgaccagtttctcattctgtcaacaagtggaggg  c.1453-241

.         .         .         .         .         .           g.13913
ttagtcagggcatcagagtcaagggtcttcagggcagagggtctttagtcactttggtcc  c.1453-181

.         .         .         .         .         .           g.13973
ctaccctgtcacccccaccaccatggaggttggtccctcccccacctgcactaagtttga  c.1453-121

.         .         .         .         .         .           g.14033
cacaggccaggaagaggggctgccaccctgaaggactctggaagaagctctgagggtcaa  c.1453-61

.         .         .         .         .         .           g.14093
ttagtccatccctctggctcagagctggacttcctgccagtcactcttgctggtctacag  c.1453-1


Powered by LOVD v.3.0 Build 17b
©2004-2016 Leiden University Medical Center